SimpleSearch - Line and FST details


Line specific information

 
Line ID 183C10
Vector Used pAC161
Line Availability only available from NASC (N417506)
Segregation Analysis 50:45:25
Confirmed for Hit At2g19480
Parent of DUPLO pair none
Parent of pair(s) 2921, 2957

Gene hit At2g19480

 
Sequence (A. th genome BLAST matches underlined)
>75-K013595-022-183-C10-8409
GTGATCCATGGTAGATTTCCCGCACATGAAGCACTTTACAATTGAATATCATTGCTGTAT
GCATGCATGTCGACCCTATGGGATCCTCCCTATAGTGAGAAGTTTTCAAGGACATCAGAG
TGTTGTCCAGCCAAATTCTGCAACTTGTTCTGCAGCAAACACGTAAATCAAATCAGGAAA
AGTCACAAACTTTCAAACAACCAAATTAAGATGCATAGACAATCCTCAAAACCAAAGTCA
AATTCTCTAAGCCATAAGAATCAAATCAATTTCTCAAAACTAGTCAGGAAGAGAAAACAA
TCCCTAAAAGTTACAAAGATGAATAGCCCAATCTCCAGATAGTCATACGCAAATCATATC
GTGAAGAAAAAACTCACCTTAAGAGCATTAACAAGCCCGGCACGATCCTCCTCGTTAAGA
GCTATAAGCAAAACACAAAACAAGAGAAGCTTTTTTCAATAAATCAAGAGAACAAAAGAG
AATCCAGGCCTCATTCTATAGGACAATAAGATTATAATATCTTACCGGTGGAGAGATCGG
ACATGTTCATGCTGTCCTTGTCGTTGCTCATCTTCGCAAGAAAAGAATCTGGCGGAGGAA
GAAGAAGGATAAGAAACCTTTAAACCCTATGGGAT
GenBank Accession AL771797 [GenBank]
Graphic View Graphic view of gene At2g19480
Predicted Position of Insertion Chr2:8439113 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3P11
Hit Gene Code At2g19480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nucleosome assembly protein 1;2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40