Sequences from confirmation amplicon


Confirmation sequences for line 187E08 and hit At2g04270 are shown.
Line ID 187E08
Locus At2g04270 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:1479202
Primers used for PCR JK15 - 8474, show primer details
   
Sequence Name 21-K020436-022-187-E08C-8409
GenBank Accession LN495477 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K020436-022-187-E08C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCAAAAGAATTAATTAGAAGC
TCTACAGAAAGAGATAAACATCCACAAGTTGGGACTATACCCTTTTTCTTGTTATCTCCA
TAAGTCCGTGTCTAGACAGCTCTGATACTTTTACCAGTGACCTATCTCTCTCCACGGCTT
TCTTAACCTCTTCATAAACGAGTCTCTTATTTGCTGAAACCCAAAAATAAAAAACAAGAG
TATACAGGACATCCATCATTCAAGAAAGGGATTTGCACATCGAGAATATTTGAATATGTG
ATTGGATGAATAAAAATGACATTCTAACTCACATTCATCTGCCATGTCGATGAAATCTAC
CACAATGATACCGCCAATATCTCTCAGCCGAATCTCCCTTGCAATCTGTTACATGATCGC
ATCGAGTATTACTTAATAAATGCTTTTCAAGATCAGCATATTGCAAAACTTGAGTAGACT
TCAAGGAGAACTACACAAGACAAGCAGGCCTCAAACAGTTACTCTTTCTCCATGTTAAAA
ATTTCCTACGGCATTCACTAG
   
Sequence Name 22-K020436-022-187-E08C-JK15
GenBank Accession LN495924 [GenBank]
Sequencing primer gene specific primer, JK15: 5'-TTATCTGATGACTAGTGAATGCCG-3'
Sequence (A. th genome BLAST matches underlined)
>22-K020436-022-187-E08C-JK15
AAATTTTTAACATGGAGAAAGAGTAACTGTTTGAGGCCTGCTTGTCTTGTGTAGTTCTCC
TTGAAGTCTACTCAAGTTTTGCAATATGCTGATCTTGAAAAGCATTTATTAAGTAATACT
CGATGCGATCATGTAACAGATTGCAAGGGAGATTCGGCTGAGAGATATTGGCGGTATCAT
TGTGGTAGATTTCATCGACATGGCAGATGAATGTGAGTTAGAATGTCATTTTTATTCATC
CAATCACATATTCAAATATTCTCGATGTGCAAATCCCTTTCTTGAATGATGGATGTCCTG
TATACTCTTGTTTTTTATTTTTGGGTTTCAGCAAATAAGAGACTCGTTTATGAAGAGGTT
AAGAAAGCCGTGGAGAGAGATAGGTCACTGGTAAAAGTATCAGAGCTGTCTAGACACGGA
CTTATGGAGATAACAAGAAAAAGGGTATAGTCCCAACTTGTGGATGTTTATCTCTTTCTG
TAGAGCTTCTAATTAATTCTTTTGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACA
TTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACGCCAT
TATTCTACTTCGGAAATCT

Last Updated on 07.07.2016 14:16