SimpleSearch - Line and FST details


Line specific information

 
Line ID 187E08
Vector Used pAC161
Line Availability only available from NASC (N417912)
Segregation Analysis 100:95:67
Confirmed for Hit At2g04270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g04270

 
Sequence (A. th genome BLAST matches underlined)
>61-K014619-022-187-E08-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCAAAAGAA
TTAATTAGAAGCTCTACAGAAAGAGATAAACATCCACAAGTTGGGACTATACCCTTTTTC
TTGTTATCTCCATAAGACCGTGGCTATGGGATCCTCCCTATAGAGAGAGCGGAGGCACTG
AACACTTACCCTGGCGCATTGGACAACATACTATACGGAGGCTTGGGAGTGTTATAATCT
CGATCCTTTTCTGTTACTTCTCTTTCCAACCAAATGAAGAACATCTCGAATAAATGATTG
GenBank Accession AL759470 [GenBank]
Graphic View Graphic view of gene At2g04270
Predicted Position of Insertion Chr2:1479202 - go to primer design
BLAST e Value 1e-41
Hit Clone Code (BAC ID) T23O15
Hit Gene Code At2g04270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNAse E/G-like
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23