Sequences from confirmation amplicon


Confirmation sequences for line 188D12 and hit At3g28840 are shown.
Line ID 188D12
Locus At3g28840 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:10838583
Primers used for PCR KS06 - 8474, show primer details
   
Sequence Name 31-K023373-022-188-D12C-8409
GenBank Accession LN499988 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K023373-022-188-D12C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTAATTCAATTGCTGATC
CAGAGACTTTCGGCCATTCGCTTGCAGAGGTATGTTGAAGTTCGTGGACGTTTTGGAGCT
TAAGTGTCCATTAAAGCCACAATACAAGAGCTTCTTCGGAAACCTAAGGTCTTACATGAA
CTTCATAAACTCGGCATCCGGGTCGAAAAACTTTGATGCCGAGCTAAAAGGGAAAGCCCA
GGGCCTCTTCTCAGCTATGTCTGCAATGAGTGGCAAAGGCGCCGCATCGGTAAAGTTCAT
TTAGATCTTAAAATGTATTTAAGTAAAGATCATCGTGGTTTGATAATGCTTGATTTATTT
CATTTTATTTGGTAACCAGGCT
   
Sequence Name 32-K023373-022-188-D12C-KS06
GenBank Accession LN500414 [GenBank]
Sequencing primer gene specific primer, KS06: 5'-CTAGAATCAGCCTGGTTACCAAAT-3'
Sequence (A. th genome BLAST matches underlined)
>32-K023373-022-188-D12C-KS06
AAAATGAAATAAATCAAGCATTATCAAACCACGATGATCTTTACTTAAATACATTTTAAG
ATCTAAATGAACTTTACCGATGCGGCGCCTTTGCCACTCATTGCAGACATAGCTGAGAAG
AGGCCCTGGGCTTTCCCTTTTAGCTCGGCATCAAAGTTTTTCGACCCGGATGCCGAGTTT
ATGAAGTTCATGTAAGACCTTAGGTTTCCGAAGAAGCTCTTGTATTGTGGCTTTAATGGA
CACTTAAGCTCCAAAACGTCCACGAACTTCAACATACCTCTGCAAGCGAATGGCCGAAAG
TCTCTGGATCAGCAATTGAATTACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGG
AAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACAT

Last Updated on 23.10.2014 13:25