SimpleSearch - Line and FST details


Line specific information

 
Line ID 188D12
Vector Used pAC161
Line Availability only available from NASC (N418000)
Segregation Analysis 100:77:54
Confirmed for Hit At3g28840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g28840

 
Sequence (A. th genome BLAST matches underlined)
>92-K014624-022-188-D12-8409
TTGATCCATGGTAGATTTCCCGGACCATGAAGCCATTACAATTGAATATATCGGAGAGCA
CGCCGAACGCGGTTACCTATGGGATCCTCCCTATAGTGAGAGNNAGNNNNATTTCGGGGA
CGTCATTGCTGCTTAAGTGCTCATTATAGCCGGACTGCAAGAGCTTCTTCGGAAACCTAA
GGTCTTACATGAACTTCATAAACTCGGCCTCCGGGTCGAAAAACTTTGATGCCGAGCTAA
AAGGGAAAGCCCAGGGCCTCTTCTCAGCTATGTCTGCAATGAGTGGCAAAGGCGCCGCAT
GGGTAAAGCTCATTTAGATCTTAAAATGTATTTAAGTAAAGATCATCGTGGTTTGATAAT
GCTTGATTTATTTCATTTTATTTGGTAACCAGGCTGAT
GenBank Accession AL759564 [GenBank]
Graphic View Graphic view of gene At3g28840
Predicted Position of Insertion Chr3:10838669 - go to primer design
BLAST e Value 2e-126
Hit Clone Code (BAC ID) T19N8
Hit Gene Code At3g28840 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF1216)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL759563 [GenBank]


Last Updated on 14.10.2014 10:23