Sequences from confirmation amplicon


Confirmation sequences for line 193F05 and hit At3g53520 are shown.
Line ID 193F05
Locus At3g53520 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:19844031
Primers used for PCR MP26 - 8474, show primer details
   
Sequence Name 23-K020436-022-193-F05C-8409
GenBank Accession LN496375 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K020436-022-193-F05C-8409
TCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGAACGAAGAC
GAAGGTAAAGGTCTCTAAGTCAGTCACACAGAGATATAGAGTATAATCCTTCTTCTGCTT
TGATTTGATATATGTATAGTCTCTTTTTCAAGAGCTCTGCTAAGTCTTTTTGTTCTCTCT
GTTTTTTCTTTTTGGTTCTATCTCCAAGACACAGATTACTACTTATATTAGCTAATGTTT
TTGACTTGGGATTTTGTCATTGGGCCATTCACCACTAGGCTCAATATTAGTGGAAAGGTA
TTGATATAAAATTTCGCTCGGTTCATACAAAAGGTTACCCTTTGTACTCTTCACATTTAC
ATATTTTTTTGGTTTTAATGTTAACACATTATATTTGTTTAAAACTTTAAATATGCATTA
GTATACTCCCTCGGTTTATACACAAAATAGCTTTTTGAATAATTTTGAAACGACATCCGA
TGGACCATTCTTGTGTTTAATATGTCTAGGTTGTTTGTTTTCGTTTGTATTTATCAGTAT
AATTGATTCAATGTTTCCAAAATAGGTTAGTATCTTAAACGAAAAGAAAGCTCTCTATGT
TTGTTGTTTGCATTTACAATTTACAAAAACTTTCAAAAATAAAAATTTGCATTGAATACT
TTTTGAATAAATCGAGGCATTTATGCAAATGGCAGCT
   
Sequence Name 24-K020436-022-193-F05C-MP26
GenBank Accession LN496817 [GenBank]
Sequencing primer gene specific primer, MP26: 5'-AGATCCCACAACTAATTTTTCAGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K020436-022-193-F05C-MP26
CCATTTGCATAAATGCCTCGATTTATTCAAAAAGTATTCAATGCAAATTTTTATTTTTGA
AAGTTTTTGTAAATTGTAAATGCAAACAACAAACATAGAGAGCTTTCTTTTCGTTTAAGA
TACTAACCTATTTTGGAAACATTGAATCAATTATACTGATAAATACAAACGAAAACAAAC
AACCTAGACATATTAAACACAAGAATGGTCCATCGGATGTCGTTTCAAAATTATTCAAAA
AGCTATTTTGTGTATAAACCGAGGGAGTATACTAATGCATATTTAAAGTTTTAAACAAAT
ATAATGTGTTAACATTAAAACCAAAAAAATATGTAAATGTGAAGAGTACAAAGGGTAACC
TTTTGTATGAACCGAGCGAAATTTTATATCAATACCTTTCCACTAATATTGAGCCTAGTG
GTGAATGGCCCAATGACAAAATCCCAAGTCAAAAACATTAGCTAATATAAGTAGTAATCT
GTGTCTTGGAGATAGAACCAAAAAGAAAAAACAGAGAGAACAAAAAGACTTAGCAGAGCT
CTTGAAAAAGAGACTATACATATATCANATCAAAGCAGAAGAAGGATTATACTCTATATC
TCTGTGTGACTGACTTAGAGACCTTTACCTTCGTCTTCGTTCCAGGATATATTCAATTGT
AAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGG
AGGAACAAGAAAGAGTAATTACCAATTTTTTT

Last Updated on 23.10.2014 13:25