SimpleSearch - Line and FST details


Line specific information

 
Line ID 193F05
Vector Used pAC161
Line Availability only available from NASC (N418497)
Segregation Analysis 100:88:66
Confirmed for Hit At3g53520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53520

 
Sequence (A. th genome BLAST matches underlined)
>38-K014649-022-193-F05-8409
TTGATCCATGTAGATTTACCCGACATGAANGCATTTACAATTGAATATATCCTAGAACGA
AGACGAAGGTAAACGTCTCTAATTCCGTCCACACAGATATAGAGTATAATCCTTCTTCTG
CTTTGATTTTGGAATATGTATAGTCTCTTTTTGAAGAGCTCTCGCTAAGCATCNTTTGGT
CTCTCTGCTNTTCTTTTTTGGTTCTATCTCCAAGACACAGATTACTACTTATATTAGCTA
ATGGTTTCTGACTTCGGATTTCGTGCATTGGGCCCTTCCCCGCTAGGCGGATTCTTCTGA
TCTTTGAGGATCTGAATCCCAAATNTCATTC
GenBank Accession AL760078 [GenBank]
Graphic View Graphic view of gene At3g53520
Predicted Position of Insertion Chr3:19844031 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F4P12
Hit Gene Code At3g53520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucuronic acid decarboxylase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23