Sequences from confirmation amplicon


Confirmation sequences for line 202H11 and hit At2g13680 are shown.
Line ID 202H11
Locus At2g13680 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:5697448
Primers used for PCR VL41 - 8474, show primer details
   
Sequence Name 15-K024285-022-202-H11C-VL41
GenBank Accession LN492795 [GenBank]
Sequencing primer gene specific primer, VL41: 5'-GGTAGATTGGTGTAATGACCTTCC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K024285-022-202-H11C-VL41
TAAAAATGCCTCATCATCTCCACCGTAAGAAGGCTTAATATTTTCTCCGGTAACGATGCT
GACATTTCCAGCCAAGAGACCATGGAGTTCATAAGCCATCTGTGCATAATCAAGAGATCA
AATTTGATATACTTTTACTGACCCATGACATCAGCCTCAAAAAGGTAAACATGTCTGAAT
GTGTTACTGACATTGTGGAAAATATAGCACAAGCATTCTGGCATGAAGCGAATATTTGCA
GCTTCTCCCCAGATGAGAAGATACAAGCCCATATTCAATTGTAAATGGCTTCATGTCCGG
GAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGT
ACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAA
ATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCC
   
Sequence Name 16-K024285-022-202-H11C-8409
GenBank Accession LN493264 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K024285-022-202-H11C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATGGGCTTGTATCTTCTCATCTG
GGGAGAAGCTGCAAATATTCGCTTCATGCCAGAATGCTTGTGCTATATTTTCCACAATGT
CAGTAACACATTCAGACATGTTTACCTTTTTGAGGCTGATGTCATGGGTCAGTAAAAGTA
TATCAAATTTGATCTCTTGATTATGCACAGATGGCTTATGAACTCCATGGTCTCTTGGCT
GGAAATGTCAGCATCGTTACCGGAGAAAATATTAAGCCTTCTTACGGTGGAGATGATGAG
GCATTTTTAAGGAAGGTCATTACACCAATCTAC

Last Updated on 07.07.2016 14:16