SimpleSearch - Line and FST details


Line specific information

 
Line ID 202H11
Vector Used pAC161
Line Availability only available from NASC (N419391)
Segregation Analysis 50:50:36
Confirmed for Hit At2g13680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g13680

 
Sequence (A. th genome BLAST matches underlined)
>88-K014485-022-202-H11-8409
NTGATCCATGGTAGATTTCCCGGACATTGAAGCCTTTACAATTGAATACTGGGCTAGCAC
TCTTTATTATCGAGGGGAGAAGCTGCAAATATTCGCTTCATGCCAGAATGCTTGTGCTAT
ATTTTCCACAATGTCAGTAACACATTCAGACATGTTTACCTTTTTGAGGCTGATGTCATG
GGTCAGTAAAAGTATATCAAATTTGATCTCTTGATTATGCACAGATGGCTTATGAACTCC
ATGGTCTCTTGGCTGGAAATGTCAGCATCGTTACCGGAGAAAATATTAAGCCTTCTTACG
GTGGAGATGATGAGGCATTTTTAAGGAAGGTCATTACACCAATCTACCGTGTAGTTCAAA
CGGTACAAGTTTGACTGATAGGTCGATGGCATTTTAAGAATCATGATCTTGTATACATCA
TAGCTAACCTTTTTTATGAGCTATGGGATCCTCC
GenBank Accession AL760811 [GenBank]
Graphic View Graphic view of gene At2g13680
Predicted Position of Insertion Chr2:5697457 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T10F5
Hit Gene Code At2g13680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation callose synthase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40