Sequences from confirmation amplicon


Confirmation sequences for line 203A07 and hit At2g24540 are shown.
Line ID 203A07
Locus At2g24540 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:10426791
Primers used for PCR SK02 - 8474, show primer details
   
Sequence Name 03-K027486-022-203-A07C-8409
GenBank Accession LN487340 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K027486-022-203-A07C-8409
AGCCATTTACATTGAATATATCCTGAGAGTGCGTGAGGAGACGAGATTTTGGTGAAAGAG
TTTGGCATGGGAGGTAAAACAAACCAACGGCCAGATGCAAGGTCAAGGGATTGCCATTGA
ATCCTAGCCGTTGATTTGTTGAAAGCGAAGACAAATAGGTAAGGAGAAGAGATAGAAAGA
GATTGCTTGGAGAAGAGGAATCTAGGGTTTGTGATGGTTTTGTTCCATGAAGATGAAACA
GAGCGATATAGAGCATGGTATGGGTAAGGAAGACGAAGAAGACAAAGCTCAGCTATATCA
TTTGGTAGACCTGAAATCAATGGCTGAGATTTTGTTCTTGTTTCTTCTTCTGCT
   
Sequence Name 04-K027486-022-203-A07C-SK02
GenBank Accession LN487779 [GenBank]
Sequencing primer gene specific primer, SK02: 5'-CACCATTAATGATCAAGCAGAAGA-3'
Sequence (A. th genome BLAST matches underlined)
>04-K027486-022-203-A07C-sk2
AGCCATTGATTTCGGTCTACCAAATGATATAGCTGAGCTTTGTCTTCTTCGTCTTCCTTA
CCCATACCATGCTCTATATCGCTCTGTTTCATCTTCATGGAACAAAACCATCACAAACCC
TAGATTCCTCTTCTCCAAGCAATCTCTTTCTATCTCTTCTCCTTACCTATTTGTCTTCGC
TTTCAACAAATCAACGGCTAGGATTCAATGGCAATCCCTTGACCTTGCATCTGGCCGTTG
GTTTGTTTTACCTCCCATGCCAAACTCTTTCACCAAAATCTCGTCTCCTCACGCACTCTC
AGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA
TGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTAC
GATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTAT
TTCGACGTGTCTACTTCA

Last Updated on 07.07.2016 14:16