SimpleSearch - Line and FST details


Line specific information

 
Line ID 203A07
Vector Used pAC161
Line Availability only available from NASC (N419399)
Segregation Analysis 100:75:69
Confirmed for Hit At2g24540
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g24540

 
Sequence (A. th genome BLAST matches underlined)
>49-K014506-022-203-A07-8409
NTGATCCATGTAGTATTTCCCGGACATGAATGCCTTTACAATTGAATATATCCTGAGAGT
GCGTGAGGAGACGAGATTTTGGTGAAAGAGTTTGGCATGGGAGGTAAAACAAACCAACGG
CCTGATGCAAGGTCAAGGGATTGCCTTTGAATCCTAGCCGTTGATTTGTTGAAAGCGAAG
ACAAATAGGTAAGGAGAAGAGATATAAAGAGATTGCTTGGAGAAGAGGAATCTATGGGAT
CCTCCCTATAGTGAGAGGNGAAAAACAATGAGTACTTACCACTGTTTTTTCAATCCTAAA
ATGT
GenBank Accession AL760823 [GenBank]
Graphic View Graphic view of gene At2g24540
Predicted Position of Insertion Chr2:10426791 - go to primer design
BLAST e Value 1e-90
Hit Clone Code (BAC ID) F25P17
Hit Gene Code At2g24540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03