Sequences from confirmation amplicon


Confirmation sequences for line 214D10 and hit At1g70210 are shown.
Line ID 214D10
Locus At1g70210 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:26440567
Primers used for PCR JM06 - 8474, show primer details
   
Sequence Name 26-K023836-022-241-D10C-8409
GenBank Accession LN497746 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K023836-022-241-D10C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATTAACTAACGTTGACGTTTT
TAAAACATTTACCGGTAATCGACGAGCGTAAAGAAACCGATCCATATAGTTAACGGCGAG
GTACGCCGTTAAAGGCTGAAAGTTATAATACGCTTGTACCTGTAAACCAAACAATACCAC
ACTACTGTAAAAAAAAAGATTCTCTGCATGTAACGATTCGATCAGCGTATTTTAGCGTCT
ACACACTCTCCGGCGGCGTATTTTAGCATTGAAAAAAATGAGAGGTAGAGAAAAAAAGTG
AATAGGCTCGCCTTGAGAATCCATGCGACGGAATCTTCTCTAGCGGAAGCATCGAGAGAT
CGAGTTTGAAATCTAGAGAGATAATCATGTCCAGGAACGAAGTGACGCTCGTCTTCGATA
AAACAAGCGATAGAATCACCAGGCCATGAATCAACCTCGGAAGACGAGAAATCAACCGTT
GACTCACCGGAAAACACACCGGAGTCTTCTCCACAAAACAAA
   
Sequence Name 30-K023836-022-241-D10C-JM06
GenBank Accession LN499558 [GenBank]
Sequencing primer gene specific primer, JM06: 5'-TAACGATATGGATTTGTTTTGTGG-3'
Sequence (A. th genome BLAST matches underlined)
>30-K023836-022-241-D10C-JM06
CGGTGTGTTTTCCGGTGAGTCAACGGTTGATTTCTCGTCTTCCGAGGTTGATTCATGGCC
TGGTGATTCTATCGCTTGTTTTATCGAAGACGAGCGTCACTTCGTTCCTGGACATGATTA
TCTCTCTAGATTTCAAACTCGATCTCTCGATGCTTCCGCTAGAGAAGATTCCGTCGCATG
GATTCTCAAGGCGAGCCTATTCACTTTTTTTCTCTACCTCTCATTTTTTTCAATGCTAAA
ATACGCCGCCGGAGAGTGTGTAGACGCTAAAATACGCTGATCGAATCGTTACATGCAGAG
AATCTTTTTTTTTACAGTAGTGTGGTATTGTTTGGTTTACAGGTACAAGCGTATTATAAC
TTTCAGCCTTTAACGGCGTACCTCGCCGTTAACTATATGGATCGGTTTCTTTACGCTCGT
CGATTACCGGTAAATGTTTTAAAAACGTCAACGTTAGTTAATTCAATTGTAAATGGCTTC
ATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAA
AGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGC

Last Updated on 23.10.2014 13:25