SimpleSearch - Line and FST details


Line specific information

 
Line ID 214D10
Vector Used pAC161
Line Availability only available from NASC (N420494)
Segregation Analysis 50:44:36
Confirmed for Hit At1g70210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g70210

 
Sequence (A. th genome BLAST matches underlined)
>76-K014139-022-214-D10-8409
TTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATAACTCACGTTGACG
TTTCTATAAACATTTACGCGGAAATCGACGAGCGTAAAGAAACCGATCCATATAGTTAAC
GGCGAGGTACGCCGTTAAAGGCTGAAAGTTATAATACGCTTGTACCTGTAAACCAAACAA
TACCACACTACTGTAAAAAAAAAGATTCTCTGCATGTAACGATTCAATCAGCGTATTTTA
GCGTCTACACACTCTCCGGCGGCGTATTTTAGCATTGAAAAAAATGAGAGGTAGAGAAAA
AAAGTGAATAGGCTCGCCTTGAAAATCCATGCGACGGAATCTTCTCTATGGGATCCTCCC
TATAAGGGAGGAAGGNACCCTTGNCACCAAATTGCAAATGGGCCGAAATAATGAGGGCTT
GAGGA
GenBank Accession AL766879 [GenBank]
Graphic View Graphic view of gene At1g70210
Predicted Position of Insertion Chr1:26440557 - go to primer design
BLAST e Value 6e-108
Hit Clone Code (BAC ID) F20P5
Hit Gene Code At1g70210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation CYCLIN D1;1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g57270

 
Sequence (A. th genome BLAST matches underlined)
>76-K014143-022-214-D10-8409
NTGATCCATGTAGATTTCCCGGACTGTAATGACTTATACTTTACAGTAATGACTTCATTA
AAACAAGACTTTACTGTTAACGTGTTGGTAATTGTAATGCCTTTATAATAACAAGTAAAA
TTATACTTCCTGTCTTTAAAACTGAAGTCGTGTGTAATCAGACTCTTAAAATTTATACAA
AATTAGTTATCTCAACTTACCTATGGGATCCTCCCTATAGTGAGANNNNNNNNNNNNNNN
NNNNNNNNNTNTNNNGNNNNNNNNNNNNANNNCNGANNNNNNNNANANGNNNANAAAAAA
NNNNAANANCCNNNNNTAAAAAACCAAAAAAAAAGAATTTTCCATATAAAATTATNATTA
TANTAAAAANNNNNANTATTTAATATAAATAAATTATAAAA
GenBank Accession AL766880 [GenBank]
Graphic View Graphic view of gene At3g57270
Predicted Position of Insertion Chr3:21191237 - go to primer design
BLAST e Value 7e-86
Hit Clone Code (BAC ID) F28O9
Hit Gene Code At3g57270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta-1,3-glucanase 1
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23