Sequences from confirmation amplicon


Confirmation sequences for line 221C10 and hit At3g47810 are shown.
Line ID 221C10
Locus At3g47810 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:17637253
Primers used for PCR IH06 - 8474, show primer details
   
Sequence Name 59-K023831-022-221-C10C-8409
GenBank Accession LN509873 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>59-K023831-022-221-C10C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAACTACGGACCAGAG
CTGGTAGTAGGGGGCTTCTTGAACTCGATCTTGTCGACTTTAACTTCTCCATCGATTAGC
TCATAGACATAGACTACAGCTCGGAAACCATCGATGTCCATAAGGACAAAGCTTGGGTTA
ACGTCTTGGTTTATGCTGCTGTAAGCTCCGGTTGCAGAGCCCGGGTTTATCACCACTCCT
CCCTCGTGTTTGTACGCTGTGAACTGGTGGGTATGGCCTGTTACGAGAATGTCGACGCCC
AGTTGTCTCTGAAGCATGGCGAGTGAGTCTAGATCACCCCATGGGATCACCTGTACCACA
AATAGAGAAGCTCGTTTTCATACCACT
   
Sequence Name 63-K023831-022-221-C10C-IH06
GenBank Accession LN510888 [GenBank]
Sequencing primer gene specific primer, IH06: 5'-CTTATTTGCAGTGGTATGAAAACG-3'
Sequence (A. th genome BLAST matches underlined)
>63-K023831-022-221-C10C-IH06
CTATTTGTGGTACAGGTGATCCCATGGGGTGATCTAGACTCACTCGCCATGCTTCAGAGA
CAACTGGGCGTCGACATTCTCGTAACAGGCCATACCCACCAGTTCACAGCGTACAAACAC
GAGGGAGGAGTGGTGATAAACCCGGGCTCTGCAACCGGAGCTTACAGCAGCATAAACCAA
GACGTTAACCCAAGCTTTGTCCTTATGGACATCGATGGTTTCCGAGCTGTAGTCTATGTC
TATGAGCTAATCGATGGAGAAGTTAAAGTCGACAAGATCGAGTTCAAGAAGCCCCCTACT
ACCAGCTCTGGTCCGTAGTTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAA
TCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACC
AATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACAT
TTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTA
TTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT

Last Updated on 23.10.2014 13:25