SimpleSearch - Line and FST details


Line specific information

 
Line ID 221C10
Vector Used pAC161
Line Availability only available from NASC (N421154)
Segregation Analysis 55:32:23
Confirmed for Hit At3g47810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g47810

 
Sequence (A. th genome BLAST matches underlined)
>75-K014206-022-221-C10-8409
NTTTGATCCCATGTAGATTTCCCGGACATGAAGCGCTTTACAATTGAATATATGCCTGAA
CTACGGACCACAGCTGGTAGTAAGGGGCTTCTAGAACTCGATCTTGACTACTTTAACTTC
TGCATCGATTAGCTCATAGACATACCACTACAGCTCGGAAACCATCGATGTCCATAAGGA
CAAAGCTTGGGTTAACGTCTTGGTTTATGCTGCTGTAAGCTCCGGTTGCAGAGCCCGGGT
TTATCACCACTCCTCCCTCGTGTTTGTACGCTGTGAACTGGTGGGTATGGCCTGTTACGA
GAATGTCGACGCCCAGTTGTCTCTGAAGCATGGCGAGTGAGTCTATGGGATCCTCCCATN
ANNGAGACTATGGGATCCTACCTATTTTAAGTTTTTGGATGCCTCCTATTGTGAGGC
GenBank Accession AL767695 [GenBank]
Graphic View Graphic view of gene At3g47810
Predicted Position of Insertion Chr3:17637253 - go to primer design
BLAST e Value 3e-140
Hit Clone Code (BAC ID) T23J7
Hit Gene Code At3g47810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcineurin-like metallo-phosphoesterase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03