Sequences from confirmation amplicon


Confirmation sequences for line 223A08 and hit At2g29750 are shown.
Line ID 223A08
Locus At2g29750 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:12710898
Primers used for PCR ZZ90 - 8474, show primer details
   
Sequence Name 18-K023359-022-223-A08C-8409
GenBank Accession LN494135 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K023359-022-223-A08C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTTCGGGTTGGTTCGAAA
CGACCAGATGAATTTGCAGTCAACGATCTCTAAGGCTTGAGCTATCTCGTTGATCTGAGT
AGCGCTGAGATTCTTCAAGCTCCCGAAACAGAGGAACACGACCGATGACTCGGGTTGGTC
ATCTAGCCAAGTTATGATCCGATCTCGTTCCGATGAGTCCAAATTCGGACGGTCGTTGGA
GCATAATATCGGCCCGATTGGGTAAATGGTTGGGTAGTTATCCGGACAACGATCGAAATA
TTTAAAACCGTTTGGCTCGAGAGCTGTGTATGAATTAACCAAAATACCCTTA
   
Sequence Name 19-K023359-022-223-A08C-ZZ90
GenBank Accession LN494585 [GenBank]
Sequencing primer gene specific primer, ZZ90: 5'-TTTCCTGAAGCTAAGGGTATTTTG-3'
Sequence (A. th genome BLAST matches underlined)
>19-K023359-022-223-A08C-ZZ90
ATTCATACACAGCTCTCGAGCCAAACGGTTTTAAATATTTCGATCGTTGTCCGGATAACT
ACCCAACCATTTACCCAATCGGGCCGATATTATGCTCCAACGACCGTCCGAATTTGGACT
CATCGGAACGAGATCGGATCATAACTTGGCTAGATGACCAACCCGAGTCATCGGTCGTGT
TCCTCTGTTTCGGGAGCTTGAAGAATCTCAGCGCTACTCAGATCAACGAGATAGCTCAAG
CCTTAGAGATCGTTGACTGCAAATTCATCTGGTCGTTTCGAACCAACCCGAAGGATATAT
TCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGT
CAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGT
CCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCG
TATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTG
TCTACATTC
Primers used for PCR ZZ91 - 8474, show primer details
   
Sequence Name 20-K023359-022-223-A08C-oriL
GenBank Accession LN495041 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>20-K023359-022-223-A08C-oriL
GCTCTCCACACGGGTTCATGGACCGGGTCATGGATCAAGGCATTGTTTGTGGTTGGGCTC
CTCAAGTTGAAATCCTAGCCCATAAAGCTGTGGGAGGATTCGTATCTCATTGTGGTTGGA
ACTCGATATTGGAGAGTTTGGGTTTCGGCGTTCCAATCGCCACGTGGCCGATGTACGCGG
AACAACAACTAAACGCGTTCACGATGGTGAAGGAGCTTGGTTTAGCCTTGGAGATGCGGT
TGGATTACGTGTCGGAAGATGGAGATATAGTGAAAGCTGATGAGATCGCAGGAACCGTTA
GATCTTTAATGGACGGTGTGGATGTGCCGAAGAGTAAAGTGAAGGAGATTGCTGAGGCGG
GAAAAGAAGCTGTGGACGGTGGATCTTCGTTTCTTGCGGTTAAAAGATTCATCGGTGACT
TGATCGACGGCGTTTCTATAAGTAAGTAGAAATGCGTCGTTTTCATGTAATTGGGCATGT
GGCGACCATGTTTCTGTTCAGATTCCTT
   
Sequence Name 21-K023359-022-223-A08C-ZZ91
GenBank Accession LN495493 [GenBank]
Sequencing primer gene specific primer, ZZ91: 5'-GAAACAAAGGAAAAAGGAATCTGA-3'
Sequence (A. th genome BLAST matches underlined)
>21-K023359-022-223-A08C-ZZ91
GGTCGCCACATGCCCAATTACATGAAAACGACGCATTTCTACTTACTTATAGAAACGCCG
TCGATCAAGTCACCGATGAATCTTTTAACCGCAAGAAACGAAGATCCACCGTCCACAGCT
TCTTTTCCCGCCTCAGCAATCTCCTTCACTTTACTCTTCGGCACATCCACACCGTCCATT
AAAGATCTAACGGTTCCTGCGATCTCATCAGCTTTCACTATATCTCCATCTTCCGACACG
TAATCCAACCGCATCTCCAAGGCTAAACCAAGCTCCTTCACCATCGTGAACGCGTTTAGT
TGTTGTTCCGCGTACATCGGCCACGTGGCGATTGGAACGCCGAAACCCAAACTCTCCAAT
ATCGAGTTCCAACCACAATGAGATACGAATCCTCCCACAGCTTTATGGGCTAGGATTTCA
ACTTGAGGAGCCCAACCACAAACAATGCCTTGATCCATGACCCGGTCCATGAACCCGTGT
GGTAGAGCCTCGTAAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTA
CCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTAC
ATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAAT
TATTCTAATTCGGAAATCTTTATTTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16