SimpleSearch - Line and FST details


Line specific information

 
Line ID 223A08
Vector Used pAC161
Line Availability only available from NASC (N421320)
Segregation Analysis 50:40:36
Confirmed for Hit At2g29750
Parent of DUPLO pair none
Parent of pair(s) 4009, 4079, 4209, 9885, 81675, 81690

Gene hit At2g29750

 
Sequence (A. th genome BLAST matches underlined)
>57-K014241-022-223-A08-8409
TGGACCGGGTCATGGATCAAGTCATTGTTTGTGGTTGGGCTCCTCAAGTTGAACTCCTAT
GGGATCCTCCCTATAGTGACGAGCTATCTACATGATATTGCGTGCGCTATTATTCTTTAT
GCATCCCGAAAAAGAGGAACACGACTTATGAACTAGGGTTGGCCGGCTATGGGATGATCC
ATATAACGAGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL767921 [GenBank]
Graphic View Graphic view of gene At2g29750
Predicted Position of Insertion Chr2:12710917 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) T27A16
Hit Gene Code At2g29750 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucosyl transferase 71C1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g18450

 
Sequence (A. th genome BLAST matches underlined)
>57-K014237-022-223-A08-8409
ATTTTGATCCATGTAGACTTTCCCGGACATGAGAGCCTTTACAATTGAATATATCCTTGC
GGGTTGGTTCGACTCGACGCAGATGAATTGGCAGTCAACGAGTCTCTAAGGCTCGAGCTA
TCTCGATGATCTGAGTAGCGCTGAGATTCTTCAAGCTCCCGAAACAGAGGAACACGACCG
ATGACTCAGGGTTGGTCATCGTATGGGATTCTCCATTNAGCGAGCGATCGTTGCTCACTC
ACGTCGCGCCGGAGAAGACACATCGGAGATCGACTAATCGATTCAGAGAGAGAGAGAGAT
AGCAGTTTTCTTCTGTAGTGTTACTTTCTGAGAGAGTCTGGAGAGATCGGTGTTGAGATT
TGGGTAACTGGAAACGAGGGAGAGAGATCTATGGGATCCTCCCT
GenBank Accession AL767920 [GenBank]
Graphic View Graphic view of gene At2g18450
Predicted Position of Insertion Chr2:8001011 - go to primer design
BLAST e Value 3e-51
Hit Clone Code (BAC ID) T30D6
Hit Gene Code At2g18450 [TAIR] [MIPS] [SIGnAL]
Gene Annotation succinate dehydrogenase 1-2
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 14.10.2014 10:23