Sequences from confirmation amplicon


Confirmation sequences for line 223B05 and hit At1g19360 are shown.
Line ID 223B05
Locus At1g19360 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:6690938
Primers used for PCR PB24 - 8474, show primer details
   
Sequence Name 94-K102437-0022-223-B05C-8409
GenBank Accession LN515300 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>94-K102437-0022-223-B05C-8409
GAAACCGCTTGGTCCCACACTTTAGCCTTAGAGAGTCTATCTGCCACGCGATCAAGCAGC
TCGATTGATGGAATTGTAGGCCTCAAATAGAAAAACCCGGAATTGAAAACCCATATCCTC
ATAGTGTGAGCATACCGAGCCCATCCCATGGCTGGTTCATCAAACACATCATTGAACCCA
TAAGCCGTATGATTGTCATGGCCATCACTCATTGACTCCACATCAGAGTCTCTGTATAGA
TGACTAAATGGGTTCTGCAAGAAGACAATGTCCACATCCGAGAGAAGAACACCATAACCG
AGTTGCAAGAACTCTCTTAACACACGGAATTTCAATCCAGAGACAGCATGGTTACCTCCA
GTTTTCCCAACAGTATCCACGTCCTTGTCTGGATCTCTCTTGTAATACGCAACATCGTTC
TCTTTACATA
   
Sequence Name 94-K102438-0022-223-B05C-PB24
GenBank Accession LN515301 [GenBank]
Sequencing primer gene specific primer, PB24: 5'-TTATGTAAAGAGAACGATGTTGCG-3'
Sequence (A. th genome BLAST matches underlined)
>94-K102438-0022-223-B05C-PB24
TGTTGGGAAACTGGAGGTAACCATGCTGTCTCTGGATTGAAATTCCGTGTGTTAAGAGAG
TTCTTGCAACTCGGTTATGGTGTTCTTCTCTCGGATGTGGACATTGTCTTCTTGCAGAAC
CCATTTAGTCATCTATACAGAGACTCTGATGTGGAGTCAATGAGTGATGGCCATGACAAT
CATACGGCTTATGGGTTCAATGATGTGTTTGATGAACCAGCCATGGGATGGGCTCGGTAT
GCTCACACTATGAGGATATGGGTTTTCAATTCCGGGTTTTTCTATTTGAGGCCTACAATT
CCATCAATCGAGCTGCTTGATCGCGTGGCAGATAGACTCTCTAAGGCTAAAGTGTGGGAC
CAAGCGGTTTTCAACGAGGAACTGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATG
AGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAA
AATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATT
ACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTT
ATTTCGACGTGTCTACATTCAC

Last Updated on 07.07.2016 14:16