SimpleSearch - Line and FST details


Line specific information

 
Line ID 223B05
Vector Used pAC161
Line Availability only available from NASC (N421329)
Segregation Analysis 50:22:15
Confirmed for Hit At1g19360
Parent of DUPLO pair none
Parent of pair(s) 581, 96350

Gene hit At1g19360

 
Sequence (A. th genome BLAST matches underlined)
>34-K014237-022-223-B05-8409
TTTGATCCATGTAGATTTCCCGGACATGAAGCACGTTCCTCGTTGAAAACCGCTTGGTCC
CACACTTTAGCCTTATAGAGTCTATCTGCCACGCGATCAAGCAGCTCGATTGATGGAATT
GTAGGCCTCAAATAGAAAAACCCGGAATTGAAAACCCATATCCTCATAGTGTGAGCATAC
CGAGCCCATCCCATGGCTGGTTCATCAAACACATGATTGAACCCATAAGCCGTATGATTG
TCATGGCCATCACTCATTGACTCCACATCAGAGTCTGTGTATAGATGACTAAATGGGTTC
TGCAAGAAGACAATGTCCACATCCGAGAGAAGAACACCATAACCGAGTTGCAAGAACTCT
CTTAACACACGGAATTTCGATCCAGAGACAGCATGGTTACCTCCAGTTTTCCCAACAGTA
TCCACGTCCTTGTCTGGATCTCTCTTGTAATACGCAACATCGATCTCTTTACATAAATTC
TCTATGTAATCGTCCAAAGCAACAACCAGATAGTTTGTTATACCCACTCTCTTAATGCTA
TGGGATCCTCTAAAGNGNCAGAGGTANNCTTGGAATATATTTGTAATGTTTTCAAGACCC
TAAAGGAATGATAATAGAAACATAATTCTTAAACCATTCTATCTACAAATAATGCGGTGG
GGAAACACACTCACTGGTACAATGAATATCGATTCTA
GenBank Accession AL767928 [GenBank]
Graphic View Graphic view of gene At1g19360
Predicted Position of Insertion Chr1:6690926 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F18O14
Hit Gene Code At1g19360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-diphospho-sugar transferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR806036 [GenBank]


Last Updated on 31.08.2016 09:40