Sequences from confirmation amplicon


Confirmation sequences for line 226C05 and hit At3g52230 are shown.
Line ID 226C05
Locus At3g52230 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:19372301
Primers used for PCR RU38 - 8474, show primer details
   
Sequence Name 15-K027342-022-226-C05C-8409
GenBank Accession LN492821 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K027342-022-226-C05C-8409
GATGAAGGACGAGAGAGTGACAAAAAGGAGGCGACGGGTGATGATGATCAGAAAGATGAT
GATGAGGATGATCAATCATCTGATGGGCATGAAGACTAGTCATATTACTTGAACACGATG
AAAATGTTACCCACTTTGGTTCTGTATAGCAAAAACACCATAAACTTCAAAATGAAGATT
TCTTATTTTCCATTGTATGTACTTGAATCTTGAGTCTCATCTCCTTATCTAAGGGGACTC
GAAATCTCTTCTCATGCTGGCAAGAAGTTTTTTTTTTCTTACTGGACAAATCTCTTGTTG
TTGCTGTGCAGTGTCTCTTTAGTTCGTGACTTGTAGTTAGATCATTGCTAGTTAAGTTTC
AAGAGATTTGTCATGTTAAATATCATAAACCGAACAAATGAACACACAAACATTATCAAC
AAATGGGATTTCAACAAACGGTCCTATAATGACCAAGTTATGAATCACATACATAACTTT
TGCCTCTTCTATACAGTATTTTGACGTTACACAAAGCTGATATTAGTCTACAGTGTATAT
AACAACC
   
Sequence Name 16-K027342-022-226-C05C-RU38
GenBank Accession LN493288 [GenBank]
Sequencing primer gene specific primer, RU38: 5'-TCTTTGTAGAGTGTGGTGGTTGTT-3'
Sequence (A. th genome BLAST matches underlined)
>16-K027342-022-226-C05C-ru38
TACGTCAAATACTGTATAGAAGAGGCAAAAGTTATGTATGTGATTCATAACTTGGTCATT
ATAGGACCGTTTGTTGAAATCCCATTTGTTGATAATGTTTGTGTGTTCATTTGTTCGGTT
TATGATATTTAACATGACAAATCTCTTGAAACTTAACTAGCAATGATCTAACTACAAGTC
ACGAACTAAAGAGACACTGCACAGCAACAACAAGAGATTTGTCCAGTAAGAAAAAAAAAA
CTTCTTGCCACCATGAAAAAAAATTTCAAGTCCCCTTAAATAAGGAGATGAAACTCAAGA
TTCAAGTACATACAATGGAAAATAAAAAATCTTCATTTTGAAGTTTATGGTGTTTTTGCT
ATACAAAACCAAAGTGGGTAACATTTTCATCGTGTTCAAGTAATATGACTAGTCTTCATG
CCCATCAAATGATTGATCATCCTCATCATCATCTTTCTAATCATCATCACCCGTCCCCTC
CTTTTTGTCACTTCTCTCGTTCCTTTCATTCCATCTGGCCCAGGCCCACTTCAGCAATGA
GTATAATGGTCAATATGGAAAAAAAAAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAAATTTCCCCACCGTTATTATAAAATGAAAGTACTTTTTGATAAAACGACAAATTA
CAATCCGTCTTATTTATGGGCAAAAGCAATAAACAAATTATTCTAATTCGAAAATCTTTA
TT

Last Updated on 23.10.2014 13:25