SimpleSearch - Line and FST details


Line specific information

 
Line ID 226C05
Vector Used pAC161
Line Availability only available from NASC (N421629)
Segregation Analysis 50:41:37
Confirmed for Hit At3g52230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g52230

 
Sequence (A. th genome BLAST matches underlined)
>35-K014261-022-226-C05-8409
GGCAAGATGGAATGAAAGGAACGAGAGAAGTGACAAAAAGGAGGCGACGGGTGATGATGA
TCAGAAAGATGATGATGAGGATGATCAATCATCTGATGGGCATGAAGGCTATGGGATCCT
CCCTATATTGAGCCTACGAGAACAAGTCGGATTTGCTCCTTTTTCATTTCATTTTTGGCT
ATAAATGCATCAGTCCTCTAACTTAGATGACTTCGATGCAACCAGTCCTCTTTACCACAT
GCTTGTATTTGGGAGAAATCCTTGCTTATCACCTACGTATTCTAATGCATCAATCACAAT
AGTCTATGTCTCTCTTACTCCCATTGCATTCTTTTGAACCGCACTCCGTGTCCACTATCA
TCAGTTACGTGAGTCATTTAGGCCCCCTATCTATGACCCCCGAATGACCCCTTCTATACA
AACCGACTCTTGTGTTCTTGACCTCCTTGTATCCATGACAGAGAATATTTCTTACTA
GenBank Accession AL761522 [GenBank]
Graphic View Graphic view of gene At3g52230
Predicted Position of Insertion Chr3:19372286 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) F4F15
Hit Gene Code At3g52230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit K19P17

 
Sequence (A. th genome BLAST matches underlined)
>35-K014265-022-226-C05-8409
AACGACATTATGATCCCGGTGATACCCTGTCCTGATGCAATGAAATGCACTTCCTTATAT
AGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGAT
ATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCT
CCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGATGGC
CTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCAC
AATAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATTACCCTCTG
ATGAAAAGTCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTA
GACAATCGTGCTCGTGCTCCACCATGTTGACCAAGATTTTCTTCTTGTCATTGAGTCGTA
AGAGACTCTGTATGAACTGTTCGCCAGTCTTTCGGGCGANTTCTGTTACGACCAAATATA
TTGGGCCTATGGG
GenBank Accession FR806105 [GenBank]
Graphic View Graphic view of sequence FR806105 of line 226C05
Predicted Position of Insertion Chr5:21913534 - go to primer design
BLAST e Value 9e-05
Hit Clone Code (BAC ID) K19P17
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03