Sequences from confirmation amplicon


Confirmation sequences for line 226G07 and hit At4g24510 are shown.
Line ID 226G07
Locus At4g24510 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:12662440
Primers used for PCR HN11 - 8474, show primer details
   
Sequence Name 18-K035348-022-226-G07C-8409
GenBank Accession LN494211 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K035348-022-226-G07C-8409
GAGCCATTTACATTGAATATACCAAAACAACACCTTTGTCTCCGACCCCATGAATCGTGT
AGTTTACGAAATCCGGCTTCCCTCCGTTGATCTCAAGTTCATACATATCTATTTCATCAA
GATTCACAAACGTTAAATTTGCACCGTACGTGAAAAAATCCGAAGAGCCTTTATCTTGTT
CTATCATCCTCTTGATCGCACCGTTTTCTTCTCTTTTTTCACCAGCAATCAGTGCAGCTA
GTTCGGATATCCCAACCATTTCGTCATTCTTTTCCACTACGCTTATTACCAAGTCCTCGT
TCCAACAGGTTGAAGACTTTTTACGG
   
Sequence Name 66-K035348-022-226-G07C-HN11
GenBank Accession LN511541 [GenBank]
Sequencing primer gene specific primer, HN11: 5'-GACCGTAAAAAGTCTTCAACCTGT-3'
Sequence (A. th genome BLAST matches underlined)
>66-K035348-022-226-G07C-HN11
CGTAGTGGAAAGATGACGAAATGGTTGGGATATCCGAACTAGCTGCACTGATTGCTGGTG
AAAAAAGAGAAGAAAACGGTGCGATCAAGAGGATGATAGAACAAGATAAAGGCTCTTCGG
ATTTTTTCACGTACGGTGCAAATTTAACGTTTGTGAATCTTGATGAAATAGATATGTATG
AACTTGAGATCAACGGAGGGAAGCCGGATTTCGTAAACTACACGATTCATGGGGTCGGAG
ACAAAGGTGTTGTTTTGGTATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACAT
GGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTT
TTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATA
AAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAAT
TCGGAAATCTTTATTTCGACGTGTCTACATTCACTCCCAAATGG

Last Updated on 23.10.2014 13:25