SimpleSearch - Line and FST details


Line specific information

 
Line ID 226G07
Vector Used pAC161
Line Availability only available from NASC (N421679)
Segregation Analysis 50:44:40
Confirmed for Hit At4g24510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g24510

 
Sequence (A. th genome BLAST matches underlined)
>55-K014261-022-226-G07-8409
CTGATCCATGGTAGATTTCCCGGACATTGAAGCCTTTACAATTGAATATACCAAAACAAC
ACCTTTGTCTCCGACCCCATGAATCGTGTAGTTTACGAAATCCGGCTTCCCTCCGTTGAT
CTCAAGTTCATACATATCTATTTCATCAAGATTCACAAACGTTAAATTTGCACCGTACGT
GAAAAAATCCGAAGAGCCTTTATCTTGTTCTATCATCCTCTTGATCGCACCGTTTTCTTC
TCTTTTTTCACCAGCAATCAGTGCAGCTATGGGATCCTCCCTTAAGTGAG
GenBank Accession AL761581 [GenBank]
Graphic View Graphic view of gene At4g24510
Predicted Position of Insertion Chr4:12662440 - go to primer design
BLAST e Value 4e-121
Hit Clone Code (BAC ID) F22K18
Hit Gene Code At4g24510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation HXXXD-type acyl-transferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40