Sequences from confirmation amplicon


Confirmation sequences for line 228E10 and hit At5g41970 are shown.
Line ID 228E10
Locus At5g41970 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:16792040
Primers used for PCR NE17 - 8474, show primer details
   
Sequence Name 25-K102590-0022-228-E10C-8409
GenBank Accession LN497388 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K102590-0022-228-E10C-8409
TTACATTGAAATATCATCAAAACAAACAAGAACTTATATCCATATGAAGAATAAACAATA
GGAACTTCTGAAATTACCTCCATGAAGCTCTTGTAGACAGCTAAAAACAACCGAAGAACA
TCAGGGTGATCTTGTTCGACATTAAGTTCCTTAGCTATGATCTCCTTTCCAAAATGCTGA
GAGTAAAACACCAACATTCAGAATTCGAAATTGACATATTCATAGAAATATCAGTGAGAA
TGAGAGCAAACACTACAATACCTTGTAAACAAGACCAGCACTACTGAGCTTAGTGTTGAA
GCCATGTCCAAAAACCTCTTCAAAACCTTTCTGGTGATGATCATAACGGTCATGCTCCGG
ATCATAAACACCTCCAACATCAAGCACTGCATCAAGTTCTGCCAATATCTACATGTACCG
TACAACAACATAGAATCATATCCTCCTCACAATTAACCCAGATTTACATCAAAAACCCCT
AATTCCAAAATTAAGCAGTCAATCTCTAGCTACTAATCAATCTCCTAATACTCATTTCCT
AAGCC
   
Sequence Name 25-K102591-0022-228-E10C-NE17
GenBank Accession LN497389 [GenBank]
Sequencing primer gene specific primer, NE17: 5'-CTGAAGTAGCTCTGGCTTAGGAAA-3'
Sequence (A. th genome BLAST matches underlined)
>25-K102591-0022-228-E10C-NE17
AGATTGACTGCTTATTTTGGAATTAGGGGTTTTTGATGTAAATCTGGGTTAATTGTGAGG
AGGATATGATTCTATGTTGTTGTACGGTACATGTAGATATTGGCAGAACTTGATGCAGTG
CTTGATGTTGGAGGTGTTTATGATCCGGAGCATGACCGTTATGATCATCACCAGAAAGGT
TTTGAAGAGGTTTTTGGACATGGCTTCAACACTAAGCTCAGTAGTGCTGGTCTTGTTTAC
AAGGTATTGTAGTGTTTGCTCTCATTCTCACTGATATTTCTATGAATATGTCAATTTCGA
ATTCTGAATGTTGGTGTTTTACTCTCAGCATTTTGGAAAGGAGATCATAGCTAAGGAACT
TAATGTCGAACAAGATCACCCTGATGTTCTTCGGTTGTTTTTAGCTGTCTACAAGAGCTT
CATGGAGGTAATTTCAGAAGTTCCTATTGTTTATTCTTCATATGGATATAAGTTCTTGTT
TGTTTTGATGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGAC
AAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAA
TCTTTATTTCGACGTGTCTACATTC
Primers used for PCR NE18 - 8474, show primer details
   
Sequence Name 26-K102590-0022-228-E10C-OriL
GenBank Accession LN497872 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K102590-0022-228-E10C-OriL
GGAATGAGCATTTACAATTGTTAGGTAATTTTTACAGGCAATTGATGCTGTGGACAATGG
AATAAACCGGTATGATACTGATCAGCCTCCACGATATGTGAACAACACACATCTGTCTCC
AAGGGTTGGAAGATTAAATCTGGATTGGATTGACCCTGACCAGTCACAAGAAAAGGAGAA
TGAAGCTTTCCAACGTGCAATGGCTCTAGCTGGAAAAGAGTTCCTCGAAGTAAGATCTCT
TTTATATAACATTATGTGCTTATTAGTTTTTTTATGTCCATTGCAATGGTAGTTTCCTAG
AGACATAACATGTTTCATAAAACAAATGTAAGCTTACACTAGTTTCTTTTATATTGTGTT
GTAGAGTGTTCAGTTCCATGCAAGATCGTGGTTACCGGCTCGATCAATTGTGATGCAGTG
TCTTGAAGAAAGATTCAAGACAGACCCCAGCGGTGAGATCATGATATTGGATAGATTTTG
CCCTGTAAGTGTTTCAATACTCGATTCCTCTTGTCCATGCTATTACTATTTGAGTCTAAA
GATATTAAACTCTGGTTCTCTTGTGAGCAGTGGAAGCTTCATTTGTTCGAGCTTGAGCAA
GAAATGAAGATCGAGCCTCTCATCAAATACGTCATTT
   
Sequence Name 26-K102591-0022-228-E10C-NE18
GenBank Accession LN497873 [GenBank]
Sequencing primer gene specific primer, NE18: 5'-AAAAGGTGTACCTGGTAAATGACG-3'
Sequence (A. th genome BLAST matches underlined)
>26-K102591-0022-228-E10C-NE18
ATTTCTTGCCAGCTCGAAAAATGAAGCTTCCACTGCTCACAAGAGAACCAGAGTTTAATA
TCTTTAGACTCAAATAGTAATAGCATGGACAAGAGGAATCGAGTATTGAAACACTTACAG
GGCAAAATCTATCCAATATCATGATCTCACCGCTGGGGTCTGTCTTGAATCTTTCTTCAA
GACACTGCATCACAATTGATCGAGCCGGTAACCACGATCTTGCATGGAACTGAACACTCT
ACAACACAATATAAAAGAAACTAGTGTAAGCTTACATTTGTTTTATGAAACATGTTATGT
CTCTAGGAAACTACCATTGCAATGGACATAAAAAAACTAATAAGCACATAATGTTATATA
AAAGAGATCTTACTTCGAGGAACTCTTTTCCAGCTAGAGCCATTGCACGTTGGAAAGCTT
CATTCTCCTTTTCTTGTGACTGGTCAGGGTCAATCCAATCCAGATTTAATCTTCCAACCC
TTGGAGACAGATGTGTGTTGTTCACATATCGTGGAGGCTGATCAGTATCATACCGGTTTA
TTCCATTGTCCACAGCATCAATTGCCTGTAAAAATTACCTAACAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAGATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 23.10.2014 13:25