SimpleSearch - Line and FST details


Line specific information

 
Line ID 228E10
Vector Used pAC161
Line Availability only available from NASC (N421850)
Segregation Analysis 50:12:9
Confirmed for Hit At5g41970
Parent of DUPLO pair 1317
Parent of pair(s) none

Gene hit At5g41970

 
Sequence (A. th genome BLAST matches underlined)
>26-K102590-0022-228-E10C-OriL
GGAATGAGCATTTACAATTGTTAGGTAATTTTTACAGGCAATTGATGCTGTGGACAATGG
AATAAACCGGTATGATACTGATCAGCCTCCACGATATGTGAACAACACACATCTGTCTCC
AAGGGTTGGAAGATTAAATCTGGATTGGATTGACCCTGACCAGTCACAAGAAAAGGAGAA
TGAAGCTTTCCAACGTGCAATGGCTCTAGCTGGAAAAGAGTTCCTCGAAGTAAGATCTCT
TTTATATAACATTATGTGCTTATTAGTTTTTTTATGTCCATTGCAATGGTAGTTTCCTAG
AGACATAACATGTTTCATAAAACAAATGTAAGCTTACACTAGTTTCTTTTATATTGTGTT
GTAGAGTGTTCAGTTCCATGCAAGATCGTGGTTACCGGCTCGATCAATTGTGATGCAGTG
TCTTGAAGAAAGATTCAAGACAGACCCCAGCGGTGAGATCATGATATTGGATAGATTTTG
CCCTGTAAGTGTTTCAATACTCGATTCCTCTTGTCCATGCTATTACTATTTGAGTCTAAA
GATATTAAACTCTGGTTCTCTTGTGAGCAGTGGAAGCTTCATTTGTTCGAGCTTGAGCAA
GAAATGAAGATCGAGCCTCTCATCAAATACGTCATTT
GenBank Accession HG968832 [GenBank]
Graphic View Graphic view of gene At5g41970
Predicted Position of Insertion Chr5:16792040 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MJC20
Hit Gene Code At5g41970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Metal-dependent protein hydrolase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL761812 [GenBank] AL761811 [GenBank]


Last Updated on 07.07.2016 14:03