Sequences from confirmation amplicon


Confirmation sequences for line 231G06 and hit At1g13420 are shown.
Line ID 231G06
Locus At1g13420 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:4604733
Primers used for PCR ND28 - 8474, show primer details
   
Sequence Name 04-K031867-022-231-G06C-ND28
GenBank Accession LN487800 [GenBank]
Sequencing primer gene specific primer, ND28: 5'-ATACCAATACGTCTTTCACGTTCC-3'
Sequence (A. th genome BLAST matches underlined)
>04-K031867-022-231-G06C-ND28
CTTTCACGGTACTTTAAGCGCATCAAAGGACATGTGGGTTGAGAACAATCTCGGAGATGA
TGATGGCAACTTGGTCAAATCCGGTTTCGAGCTTTTGAGATAAAGATCGAGCTCGAGGTA
CGGCACTAGCTCATGAGGATTATGAGTTAGCAGAGGATGATTGTCTGAAGTGTGTTTTGA
TCTTTGCGCGAGTGCGAATGTGAGTGCCTTGAGCCAAGTCGTACCCGATTTGGGGAAAGA
AGCAACAATTATATCCGTTTCTTGTGGCTGAAAGTTTTTGTTGAAATTGAGGATTGCTTG
GAGAATATCTTTGTCGTACCAACATCCTTGGTACTTGTACAACTTGGTCCCTGAGCAATC
TATGTCTGAAGGAAGTGAAGAGATCAAACTTTTGGTTTCTTCACTTTGGTTTTCTTCTTC
TTCTTCTTCTTCTTCCTTCAAGTTCCTTGGAAATTTTGGCTTCAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACTTC
   
Sequence Name 03-K031867-022-231-G06C-8409
GenBank Accession LN487365 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K031867-022-231-G06C-8409
GCCATTTACAATTGAAGCCAAATTTCCAGGAACTTGAAGGAAGAAGAAGAAGAAGAAGAA
GAAAACCAAAGTGAAGAAACCAAAAGTTTGATCTCTTCACTTCCTTCAGACATAGATTGC
TCAGGGACCAAGTTGTACAAGTACCAAGGATGTTGGTACGACAAAGATATTCTCCAAGCA
ATCCTCAATTTCAACAAAAACTTTCAGCCACAAGAAACGGATATAATTGTTGCTTCTTTC
CCCAAATCGGGTACGACTTGGCTCAAGGCACTCACATTCGCACTCGCGCAAAGATCAAAA
CACACTTCAGACAATCATCCTCTGCTAACTCATAATCCTCATGAGCTAGTGCCGTACCTC
GAGCTCGATCTTTATCTCAAAAGCTCGAAACCGGATTTGACCAAGTTGCCATCATCATCT
CCGAGATTGTTCTCAACCCACATGTCCTTTGATGCGCTTAAAGTACCGTTGAAAGAGTCT
CCTTGCAAGATCGTGTACGTGTGCAGGAACGTGAAAGACTAATTGGTA
Primers used for PCR FP92 - 8474, show primer details
   
Sequence Name 06-K035332-022-231-G06C-8409
GenBank Accession LN488708 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>06-K035332-022-231-G06C-8409
TTCCGGACTGAGCCATTTAAATTGAATATATCCTGAGACTACTATGCAATGTTTATATGT
TCATTGCTGTTCATTGGCTTCAATTGAATATTTCCCGGATCTTTCATATCTTGAGAGATC
CTTTATAACGTTCATGAAATAACGTGGTGGTTGATTTATTTTTTTCAACCCGTAATATAA
GATTGTTAAATTACAAACATACAAAAGTCCAACTAACTTATATTTGGATTTTAGCCTCAA
AAACAAAACTTGTATTTGGTGGCATAAGAGGCATAATATCAAGTTGATAAGACATTTTGT
TTTGTATACCAATAAAGTGATCTTGAAATCTTGAGTGATCGAAGTTGGTGGCATGAAACG
ATTTCTAGCAATTCGAAACTGGCAACGTGATTTGTAAATTGTTGTAAGAAAATGTTAACT
ACTACAAATTCTTTCCTTTTTTTTCTTTTAATACAAATTCATTGACCTGAAGTTTCCGGT
TCTACATCGCAGAAAGTTGTTAACAGCT
   
Sequence Name 06-K035332-022-231-G06C-FP92
GenBank Accession LN488709 [GenBank]
Sequencing primer gene specific primer, FP92: 5'-TTAGCTGTAAACAACTTTCTGCGA-3'
Sequence (A. th genome BLAST matches underlined)
>06-K035332-022-231-G06C-FP92
TCATGAATTTGTATAAAAGAAAAAAAGGAAAGAATTTGTAGTAGTTAACATTTTCTTACA
CAATTTACAAATCACGTTGCCAGTTTCGAATTGCTAGAAATCGTTTCATGCCACCAACTT
CGATCACTCAAGATTTCAAGATCACTTTATTGGTATACAAAACAAAATGTCTTATCAACT
TGATATTATGCCTCTTATGCCACCAAATACAAGTTTTGTTTTTGAGGCTAAAATCCAAAT
ATAAGTTAGTTGGACTTTTGTATGTTTGTAATTTAACAATCTTATATTACGGGTTGAAAA
AAATAAATCAACCACCACGTTATTTCATGAACGTTATAAAGGATCTCTCAAGATATGAAA
GATCCGGGAAATATTCAATTGAAGCCAATGAACAGCAATGAACATATAAACATTGCATAG
TAGTCTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGAC
CAATTACCATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAA
TCTTTATTTCGACGTGTCTACATTCACGTCCCAATGGGA

Last Updated on 07.07.2016 14:16