SimpleSearch - Line and FST details


Line specific information

 
Line ID 231G06
Vector Used pAC161
Line Availability only available from NASC (N422158)
Segregation Analysis 97:93:74
Confirmed for Hit At1g12570 At1g13420
Parent of DUPLO pair 12903
Parent of pair(s) 4414, 4638, 4664, 4693, 4825, 4867, 4873, 4951, 7328, 8522, 11283, 90489, 90490, 90491, 90492, 90494
Note Although the line exists, the insertion in At3g57854 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g12570

 
Sequence (A. th genome BLAST matches underlined)
>47-K014317-022-231-G06-8409
GGTTGGATCCATGTAGACTTTCCTGGACATGAANGCCTTTACAATTGAAGCTCAATTGGA
GATCCATCTTACTCGGCTTCGACATATGTTCCTTCCCCGGTAATCCCAACAACCTCAATG
AGTGAGACCTCAACGGGGACTGGAGAAGGAACGAACACGGCATTCATAGGGTTGTCATAC
ATGCCTTGACCCACATGAGGCTGGTCCATCACCACCGTGATGTTTTGGGCCTGTAATTGA
GCCGATGGGCCAACACCACTTAGCATAAGAAGTTGTGGGCTCACTATGGGATCCTCC
GenBank Accession CT026192 [GenBank]
Graphic View Graphic view of gene At1g12570
Predicted Position of Insertion Chr1:4278919 - go to primer design
BLAST e Value 2e-114
Hit Clone Code (BAC ID) F5O11
Hit Gene Code At1g12570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glucose-methanol-choline (GMC) oxidoreductase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g57854

 
Sequence (A. th genome BLAST matches underlined)
>67-K020163-022-231-G06t-8409
CTCAAAACGGGGTAGGGAGGGGTGAGAATATTTTCCAATCGGATTTTTCCTTTGAGGATA
TATGCATACTTCACAAACGATATCGGAGATGGTTTGGTGCTAAATCCTATGGGATCCTCC
CTATAGTGAGATCCNNAGGANNNNNNNNNTNNNNNNTNNNNNNNAANACNNAAANNNAAT
TAAACCCCCCCATCCTAAATCTTCATCCCCTTCATCTACCTCTTCCCTCATATTCCTTCT
CCACCATTCCATTTTTCTTTATACCACCCATATCAATCCTCCCACTACCTATCATTTTCC
ACTATCTTCACAATAAANTNACAAATANCTANNCAATNNAATCCAANNATNTTTCCNNAT
ATTACCCTTTNTTCAAAANTCTCAATTNCCCT
GenBank Accession BX530841 [GenBank]
Graphic View Graphic view of gene At3g57854
Predicted Position of Insertion Chr3:21425532 - go to primer design
BLAST e Value 2e-28
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g57854 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 412C05

Gene hit At1g13420

 
Sequence (A. th genome BLAST matches underlined)
>47-K014313-022-231-G06-8409
CTGATCCATGTAGATTNTCCCGGNACATGAAGCCTTTACAATTGAATACTATAGCTTGAC
CAATGACATGTGAAGCGATGATAGGAAAACATATCATGAAAGAGAGCCGCGGTGAGATGA
AAGCGCGAAGTTTGATCTCTTTACTTACTTCAAACATAGATTGCTCAGGGACCAAGTTGT
ACAAGTACCAAGGATGTTGGTACGACAAAGATATTCTCCAAGCAATCCTCAATTTCAACA
AAAACTTTCAGCCACAAGAAACGGATATAATTGTTGCTTCTTTCCCCAAATCGGGTACGA
CTTGGCTCAAGGCACTCACATTCGCACTCGCGCAAAGATCAAAACACACTTCAGACAATC
ATCCTCTGCTAACTCATAATCCTCATGAGCTATGGGATCCTC
GenBank Accession AL938012 [GenBank]
Graphic View Graphic view of gene At1g13420
Predicted Position of Insertion Chr1:4604879 - go to primer design
BLAST e Value 8e-141
Hit Clone Code (BAC ID) T6J4
Hit Gene Code At1g13420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sulfotransferase 4B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL938012 [GenBank]


Last Updated on 31.08.2016 09:40