Sequences from confirmation amplicon


Confirmation sequences for line 235F11 and hit At4g17420 are shown.
Line ID 235F11
Locus At4g17420 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:9723085
Primers used for PCR PP40 - 8474, show primer details
   
Sequence Name 09-K102723-0022-235-F11C-8409
GenBank Accession LN490128 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K102723-0022-235-F11C-8409
TTACCGTCAATGGTAATTAAAAGGCCTAAACCTAAAGAGCAGTAAGTTGAGATAAACTTT
AGTTGCATACCAGAGCCGCCAGCGATAATAAAAGCAAGACCCTGACCAGAAAGCCTTTGT
CTCAGAACCCCCTACAACAACGACTCTCTGACTTCAAGCCAAACATATATAAAATTTTCA
CATAGTAGCATCTACAAGAAGTAACTAGGAAAGGTATAACTCTTAAGTTTTGAATGAACT
GTGCCAAAAGCCAATGCAATGTATTGTTTTCCTTACCTCAGCCCCAGCTGCAGCAATGTT
TCTTGCTCGATGTCTCTGATACACAGTGTTTACGACCTTCACATCATGGACAGAACAGAG
AAATGCATCTGGCTACACAACACAAGGAAAAAA
   
Sequence Name 25-K102728-0022-235-F11C-PP40
GenBank Accession LN497391 [GenBank]
Sequencing primer gene specific primer, PP40: 5'-CTTTTTCTTGTTGTTGTGTAGCCA-3'
Sequence (A. th genome BLAST matches underlined)
>25-K102728-0022-235-F11C-PP40
TGAGGTCGTAACACTGTGTATCAGAGACATCGAGCAAGAAACATTGCTGCAGCTGGGGCT
GAGGTAAGGAAAACAATACATTGCATTGGCTTTTGGCACAGTTCATTCAAAACTTAAGAG
TTATACCTTTCCTAGTTACTTCTTGTAGATGCTACTATGTGAAAATTTTATATATGTTTG
GCTTGAAGTCAGAGAGTCGTTGTTGTAGGGGGTTCTGAGACAAAGGCTTTCTGGTCAGGG
TCTTGCTTTTATTATCGCTGGCGGCTCTGGTATGCAACTAAAGTTTATCTCAACTTACTG
CTCTTTAGGTTTAGGCCTTTTAAATTACCATTTGACGGGTAAACCTAAGAAATCTACATG
GATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTT
TTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAA
AACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATT
CGGAAATCTTTATTTCGACGTGTCTACATT

Last Updated on 23.10.2014 13:25