SimpleSearch - Line and FST details


Line specific information

 
Line ID 235F11
Vector Used pAC161
Line Availability only available from NASC (N422535)
Segregation Analysis 50:32:30
Confirmed for Hit At4g17420
Parent of DUPLO pair 1569
Parent of pair(s) none

Gene hit At4g17420

 
Sequence (A. th genome BLAST matches underlined)
>86-K014334-022-235-F11-8409
TGTAGATTTCTTAGGTTTACCCGTCAAATGGTAATTTAAAAGGCCTAAACCTATAGAGCG
GGAAGTTGAGATAATATTTACCGCATACCAGAGCCGCCAGCGATAATAAAAGCAAGACCC
TGACCAGAAAGCCTTTGTCTCAGAACCCCCTACAACAACGACTCTCTGACTTCAAGCCAA
ACATATATAAAATTTTCACATAGTAGCATCTACAAGAAGTAACTAGGGGATAGAACAAAC
GACTGTATTATATTACACCGACACTAAGGAAATGTCTGATTCCTTGTTGCCTGTGGGATG
CT
GenBank Accession AL938522 [GenBank]
Graphic View Graphic view of gene At4g17420
Predicted Position of Insertion Chr4:9723084 - go to primer design
BLAST e Value 4e-84
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tryptophan RNA-binding attenuator protein-like
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23