SimpleSearch - Line and FST details


Line specific information

 
Line ID 235F11
Vector Used pAC161
Line Availability only available from NASC (N422535)
Segregation Analysis 50:32:30
Confirmed for Hit At4g17420
Parent of DUPLO pair 1569
Parent of pair(s) none

Gene hit At4g17420

 
Sequence (A. th genome BLAST matches underlined)
>86-K014338-022-235-F11-8409
TTAAAAGGCCTAGACCTATATAGACAGTAAGGTGAGATAAACATTACTCGCATACCATAG
CCGCCAGCGATAATTGAAGCAACGACCCTGACCAGACAGCCTTTGTCTCAGAACCCCCTA
CACCGACGACTCTCTGACCTTCAAGGCCAACGCTACTATAGAAATTTTCACATATTATCA
TCTACAAGAAGGACCTATGGGATACTCCCTTACCGGATGTTATTAATCTTATCTATGGGA
TCCTCCCATTAGTGAGTGANGCCGCTCTGAGANCGCTCTTACAGACGGACTCTGCCGAGG
CTGATGGTGCTTCTGGATACTGCCTGTAGTGGAAATTACCAGAA
GenBank Accession FR806264 [GenBank]
Graphic View Graphic view of gene At4g17420
Predicted Position of Insertion Chr4:9723085 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tryptophan RNA-binding attenuator protein-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR806264 [GenBank]


Last Updated on 31.08.2016 09:40