Sequences from confirmation amplicon


Confirmation sequences for line 237E06 and hit At5g58460 are shown.
Line ID 237E06
Locus At5g58460 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:23633886
Primers used for PCR RK94 - 8474, show primer details
   
Sequence Name 07-K027433-022-237-E06C-8409
GenBank Accession LN489122 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K027433-022-237-E06C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCAATTGTTAATGAA
TTCTTGATGCCTTTCTCTTTTGCTTTGGTGGGACAAAAAACCAATGTCAACTTAATTAGC
AAAGAGACGTGGCCCAAACAGATCTCTCCTCTTATCTACATGAGCATCGTTGGCTTCGTC
ACCAAGTTTGTCTCTTCCACTGGCGCTGCTCTCTTCTTTAAAGTCCCCACTAGGGACAGT
CTCACGCTTGGCCTGATGATGAACTTGAGAGGCCAGATCGATATCTTACTCTACTTGCAT
TGGATCGACAAACAAATGGTAGGCTTACCCGGTTATTCTGTCATGGTTTTGTATGCGATC
GTGGTCACGGGTGTAACAGCGCCGCTAATCAGCTTCCTCTACGATCCCACTCGGCCTTAT
AGAAGCAGCAAGCGCCGCACAATCCAACACACTCCTCAGAACACCGAGACGGGACTAGTT
CTTGCAGTAACCGACCATGATACCTTCTCAGGCTTGATCACGTTTCTAGACTTCGCTTAT
CCCACTAAAACTAGTCCTTTCTCT
   
Sequence Name 08-K027433-022-237-E06C-RK94
GenBank Accession LN489585 [GenBank]
Sequencing primer gene specific primer, RK94: 5'-GAATTGCGAATACAGAGAAAGGAC-3'
Sequence (A. th genome BLAST matches underlined)
>08-K027433-022-237-E06C-RK94
TAGTTTTAGTGGGATAAGCGAAGTCTAGAAACGTGATCAAGCCTGAGAAGGTATCATGGT
CGGTTACTGCAAGAACTAGTCCCGTCTCGGTGTTCTGAGGAGTGTGTTGGATTGTGCGGC
GCTTGCTGCTTCTATAAGGCCGAGTGGGATCGTAGAGGAAGCTGATTAGCGGCGCTGTTA
CACCCGTGACCACGATCGCATACAAAACCATGACAGAATAACCGGGTAAGCCTACCATTT
GTTTGTCGATCCAATGCAAGTAGAGTAAGATATCGATCTGGCCTCTCAAGTTCATCATCA
GGCCAAGCGTGAGACTGTCCCTAGTGGGGACTTTAAAGAAGAGAGCAGCGCCAGTGGAAG
AGACAAACTTGGTGACGAAGCCAACGATGCTCATGTAGATAAGAGGAGAGATCTGTTTGG
GCCACGTCTCTTTGCTAATTAAGTTGACATTGGTTTTTTGTCCCACCAAAGCAAAAGAGA
AAGGCATCAAGAATTCATTAACAATTGGATATATTCAATTGTAAATGGCTTCATGTCCGG
GAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGT
ACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAA
ATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA

Last Updated on 23.10.2014 13:25