SimpleSearch - Line and FST details


Line specific information

 
Line ID 237E06
Vector Used pAC161
Line Availability only available from NASC (N422710)
Segregation Analysis 100:97:87
Confirmed for Hit At5g58460
Parent of DUPLO pair 2791
Parent of pair(s) none

Gene hit At5g58460

 
Sequence (A. th genome BLAST matches underlined)
>45-K014336-022-237-E06-8409
TGATCCATGTAGATTTCCCGGACTGAANGCCTTTACAATTGAATTATCCAATGTGTGTAA
CTAATGCTTGATGCCTTTCTCATTAGCTTTGGTGGGACAAGAAAGACACATGTCAACTTA
ATTAGCAAAGAGACGTGGCCCAAACAGATCTCTCCTCTTATCTACATGAGCATCGTTGGC
TTCGTCACCAAGTTTGTCTCTTCCACTGGCGCTGCTCTCTTCTTTAAAGTCCTCACTATG
GGATCCTCCCTGTAGTGAGTTTTTA
GenBank Accession AL938754 [GenBank]
Graphic View Graphic view of gene At5g58460
Predicted Position of Insertion Chr5:23633881 - go to primer design
BLAST e Value 1e-71
Hit Clone Code (BAC ID) MQJ2
Hit Gene Code At5g58460 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cation/H+ exchanger 25
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23