Sequences from confirmation amplicon


Confirmation sequences for line 241G12 and hit At2g47490 are shown.
Line ID 241G12
Locus At2g47490 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:19489307
Primers used for PCR BG35 - 8474, show primer details
   
Sequence Name 72-K101747-0022-241-G12C-8409
GenBank Accession LN512697 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>72-K101747-0022-241-G12C-8409
CGGATTTAGTATAGAGCTTTGCTCAGAAGGTATATGAGTGACGAGGAAACGATGCACCAT
TTCGAAGCTAGTGAAAGTTATAACTGCTGCAGGAGTTGTTCTCAGTAGATTCGTGGCGCA
GCCTCTGTAAAAACCAGGGAACCCATCTTTCTCAAACACTTTCTTGATGCAATCTCTTAC
TCCTGAGTAACGTTTCTCACTGTGGTGCCCTTGCTCTTGAAGCCTAGCTCGTACTACCTG
CACACCGCGAGATCAACATGTTTCATTCAAACCATAAACCAAAAGCCAAACTGATGACTA
TGAGAGTAGAGGTTTGTACCTCGTGCGGGTAAGTTAATGTGGATGCAAATATCTTTGCAA
TCGAAGAGGCAACTGCTACATCACGAGCATTGAGGTTATCGACTGATTTATCACCTGTTG
AGTTCACAAATCTTTATCTTATCATATCTCCACTAAGATTTCACCTTTCTTTTGTTTTAC
TTCATCCAATTCAAAAGATTTATGGATTACCTTTCTTGGCCAAGTACACTTTGATCATCT
CAATGNTGGGAA
   
Sequence Name 72-K101753-0022-241-G12C-BG35
GenBank Accession LN512698 [GenBank]
Sequencing primer gene specific primer, BG35: 5'-TTTCCCACATATGAGATGATCAAA-3'
Sequence (A. th genome BLAST matches underlined)
>72-K101753-0022-241-G12C-BG35
TCTTTTGATTGGATGAAGTAAAACAAAAGAAAGGTGAAATCTTAGTGGAGATATGATAAG
ATAAAGATTTGTGAACTCAACAGGTGATAAATCAGTCGATAACCTCAATGCTCGTGATGT
AGCAGTTGCCTCTTCGATTGCAAAGATATTTGCATCCACATTAACTTACCCGCACGAGGT
ACAAACCTCTACTCTCATAGTCATCAGTTTGGCTTTTGGTTTATGGTTTGAATGAAACAT
GTTGATCTCGCGGTGTGCAGGTAGTACGAGCTAGGCTTCAAGAGCAAGGGCACCACAGTG
AGAAACGTTACTCAGGAGTAAGAGATTGCATCAAGAAAGTGTTTGAGAAAGATGGGTTCC
CTGGTTTTTACAGAGGCTGCGCCACGAATCTACTGAGAACAACTCCTGCAGCAGTTATAA
CTTTCACTAGCTTCGAAATGGTGCATCGTTTCCTCGTCACTCATATACCTTCTGAGCAAA
GCTCTATACTTTAAATCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATAT
GGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATATCC

Last Updated on 07.07.2016 14:16