SimpleSearch - Line and FST details


Line specific information

 
Line ID 241G12
Vector Used pAC161
Line Availability only available from NASC (N423124)
Segregation Analysis 50:19:15
Confirmed for Hit At2g47490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g47490

 
Sequence (A. th genome BLAST matches underlined)
>95-K014371-022-241-G12-8409
GATCCTGTAGATTTCCCTGATTAAAGATAGAGCTTTGCTCAGAGGTATATGAGTGACTGA
TGAAACGATGCACCATTTCGAGCTAGTGAAAGTTATAACTGCTGCAGGAGTTGTTCTCAG
TAGATTCGTGGCGCAGCCTCTGTAAAAACCAGGGAACCCATCTTTCTCAAACACTTTCTT
GATGCAATCTCTTACTCCTGAGTAACGTTTCTCACTGTGGTGCCCTTGCTCTTGAAGCCT
ATGGGATCCTC
GenBank Accession AL939806 [GenBank]
Graphic View Graphic view of gene At2g47490
Predicted Position of Insertion Chr2:19489304 - go to primer design
BLAST e Value 1e-102
Hit Clone Code (BAC ID) T30B22
Hit Gene Code At2g47490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD+ transporter 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03