Sequences from confirmation amplicon


Confirmation sequences for line 244G02 and hit At1g05100 are shown.
Line ID 244G02
Locus At1g05100 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:1470368
Primers used for PCR DL86 - 8474, show primer details
   
Sequence Name 10-K018753-022-244-G02C-DL86
GenBank Accession LN490441 [GenBank]
Sequencing primer gene specific primer, DL86: 5'-CTTCTTGGGTTGGAGTACATTCAT-3'
Sequence (A. th genome BLAST matches underlined)
>10-K018753-022-244-G02C-DL86
TCAAAGGGAATTGCGCATTGCGACATTAAGGGAAGCAACGTGTTGGTCGGAGAGAACGGA
GAAGCCAAGATCGCTGATTTCGGGTGTGCGAAATGGGTTGAACCGGAAATAACCGAACCG
GTTAGAGGAACGCCGGCGTTCATGGCTCCAGAAGCGGCGCGTGGAGAGAGACAAGGGAAA
GAGAGTGATATATGGGCGGTGGGTTGTACGGTGATAGAGATGGTTACCGGGTCTCAGCCG
TGGATTGGGGCGGATTTTACCGACCCGGTTTCCGGTCTTTACCGGGTCGGATAT
   
Sequence Name 14-K018753-022-244-G02C-8409
GenBank Accession LN492299 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K018753-022-244-G02C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAAAAATCCTGCGCAAGGCAGCT
CTGGTAACTCACCTAAATATCCGACCCGGTAAAGAACCGAAACCGGGTCGGTAAAATCCG
CCCCAATCCACGGCTGAGACCCGGTAACCATCTCTATCACCGTACAACCCACCGCCCATA
TATCACTCTCTTTCCCTTGTCTCTCTCCACGCGCCGCTTCTGGAGCCATGAACGCCGGCG
TTCCTCTAACCGGTTCGGTTATTTCCGGTTCAACCCATTTCGCACACCCGAAATCAGCGA
TCTTGGCTTCTCCGTTCTCTCCGACCAACACGTTGCTTCCCTTAATGTCGCAATGCGCAA
TTCCCTTTGAGTTATGAATGTACTCCAACCCAAGAA

Last Updated on 23.10.2014 13:25