SimpleSearch - Line and FST details


Line specific information

 
Line ID 244G02
Vector Used pAC161
Line Availability only available from NASC (N423402)
Segregation Analysis 100:80:61
Confirmed for Hit At1g05100
Parent of DUPLO pair 2738
Parent of pair(s) none

Gene hit At1g05100

 
Sequence (A. th genome BLAST matches underlined)
>15-K014390-022-244-G02-8409
CTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATACCCTGCCGGC
GCTGCTCGCGTGTTGCACCCGGTGGAACTTGCACTCGTTGGTTCCCGGATACTCAGTTGC
AAAGGATATTTTTACGAAAGTGTTTGATGAAAGAAGCGACGGATATATGGACCGCGACTC
ACCTACTAAACCATCCGTTTTTGGTTAATATAGAACCGGAATTGGTCACCGGTTTGGTTA
CAAACTCACCGACAAGTGTGACGGATCAAATGTTCTGGAGATCACAGGAAAAGGAGGTGT
CACAGGACCGTTCAAGCTGGTGGGAATGTTATGAGGATGAGAGAATTGGAGTGCTTAACT
GGATTGGTCATGTTGTGCCGGAGACCACATGAGACTCGGACGGCGAGGATTGGTATACCG
GTCGACCGAATTAACCCGTTCACATGAAGG
GenBank Accession BX942901 [GenBank]
Graphic View Graphic view of gene At1g05100
Predicted Position of Insertion Chr1:1470384 - go to primer design
BLAST e Value 1e-99
Hit Clone Code (BAC ID) T7A14
Hit Gene Code At1g05100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase kinase kinase 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942901 [GenBank]


Last Updated on 31.08.2016 09:40