Sequences from confirmation amplicon


Confirmation sequences for line 245E11 and hit At4g34590 are shown.
Line ID 245E11
Locus At4g34590 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:16522767
Primers used for PCR MR84 - 8474, show primer details
   
Sequence Name 27-K018756-022-245-E11C-MR84
GenBank Accession LN498175 [GenBank]
Sequencing primer gene specific primer, MR84: 5'-CAAATTTCTCTTCTTCGTTTTTCG-3'
Sequence (A. th genome BLAST matches underlined)
>27-K018756-022-245-E11C-MR84
CTGGGTCCTGTCCTGTTCTGTTGTGTCTTGTTCTGTTCTGTTTTTAATTCCCCTAAAAAC
CCATTTTAAAATATTTTATCTCTCTTCTCTTAAAAAAAACTCTTCCCTGTTTTTGTTTGT
GTGTTACTAAATGGAATCGTCGTCGTCGGGAACAACTTCGTCGACGATTCAAACGTCGTC
AGGATCGGAGGAGAGTCTCATGGAGCAGAGGAAACGTAAACGGATGCTCTCAAACCGTGA
ATCTGCAAGGAGATCAAGAATGAAGAAACAAAAGCTCCTAGACGATCTAACGGCTCAGGT
TAATCATCTGAAAAAAGAGAACACGGAGATCGTGACAAGTGTCAGCATCACAACGCAACA
CTACCTAACCGTTGAAGCAGAGAACTCTGTTCTCAGAGCTCAGCTTGATGAACTTAACCA
CAGGCTCCAATCTCTCAACGACATCATCGTCAATGAGTATATTCAATTGTAAATGGCTTC
ATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACA
   
Sequence Name 28-K018756-022-245-E11C-8409
GenBank Accession LN498646 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K018756-022-245-E11C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATACTCATTGACGATGATG
TCGTTGAGAGATTGGAGCCTGTGGTTAAGTTCATCAAGCTGAGCTCTGAGAACAGAGTTC
TCTGCTTCAACGGTTAGGTAGTGTTGCGTTGTGATGCTGACACTTGTCACGATCTCCGTG
TTCTCTTTTTTCAGATGATTAACCTGAGCCGTTAGATCGTCTAGGAGCTTTTGTTTCTTC
ATTCTTGATCTCCTTGCAGATTCACGGTTTGAGAGCATCCGTTTACGTTTCCTCTGCTCC
ATGAGACTCTCCTCCGATCCTGACGACGTTTGAATCGTCGACGAAGTTGTTCCCGACGAC
GACGATTCCATTTAGTAACACACAAACAAAAACAGGGAAGAGTTTTTTTTAAGAGAAGAG
AGATAAAATATTTTAAAATGGGTTTTTAGGGGAATTAAAAACAGAACAGAACAAGACACA
ACAGAACAGGACAGGACCCAGATGACGAAAAACGAA

Last Updated on 07.07.2016 14:16