SimpleSearch - Line and FST details


Line specific information

 
Line ID 245E11
Vector Used pAC161
Line Availability only available from NASC (N423483)
Segregation Analysis 50:7:5
Confirmed for Hit At4g34590
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g34590

 
Sequence (A. th genome BLAST matches underlined)
>85-K014391-022-245-E11-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATACTCATTGACG
ATGATGTCGTTGAGAGATTGGAGCCTGTGGTTAAGTTCATCAAGCTGAGCTCTGAGAACA
GAGTTCTCTGCTTCAACGGTTAGGTAGTGTTGCGTTGTGATGCTGACACTTGTCACGATC
TCCGTGTTCTCTTTTTTCAGATGATTAACCTGAGCCGTTAGATCGGCTATGGGATCCTCC
CTTAGGTGAG
GenBank Accession AL940227 [GenBank]
Graphic View Graphic view of gene At4g34590
Predicted Position of Insertion Chr4:16522767 - go to primer design
BLAST e Value 2e-89
Hit Clone Code (BAC ID) T4L20
Hit Gene Code At4g34590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation G-box binding factor 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03