Sequences from confirmation amplicon


Confirmation sequences for line 246F07 and hit At2g35980 are shown.
Line ID 246F07
Locus At2g35980 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15111083
Primers used for PCR TK01 - 8474, show primer details
   
Sequence Name 13-K024066-022-246-F07C-8409
GenBank Accession LN491860 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K024066-022-246-F07C-8409
TAGATTTCCCGGACATGAAGCCATTTTTGAAGCCATATGTTTTTCTTTTGGCCTTGGAAC
GTTGGTGTGAGAACGGTTGTGTTTTTGTGTCCTTGATAGAAAGGAGTTAACGTGATGGTA
CTAAACCGCTTTCCCTCGTAGTAGGCATGAGCTTCGATCCTATCGTAGTAGAGTCCGATC
CTCTTGTTTGGGTTACGGACAGGAACAGTGAGGGCTAGGTTATACCTTAAAATGTTGTCC
GGGGAAGTGTGGTCAAAGCGGGTAAGGGACGCATCGGTCACGTGAAACTTGATGGCACGA
GGTCGGACGATGAGCCAGAAGATGAGAGCGGCTACGCCGAGGATGACAATAAGGGATATG
ATTACTTTGACGAATAAGCTGAGGAGGCAGCAGCCACAGCCACGACCGTGCCCACGTCGG
TAGTAGCCTTTGGGAGCTGGTGGTGGGACTGATGGACCGTAGAAGGCGCCATTGAGAGGT
TGTTCAGCAGC
   
Sequence Name 14-K024066-022-246-F07C-TK01
GenBank Accession LN492330 [GenBank]
Sequencing primer gene specific primer, TK01: 5'-ATTACTATCATGGCTGCTGAACAA-3'
Sequence (A. th genome BLAST matches underlined)
>14-K024066-022-246-F07C-TK01
TGGCGCCTTCTACGGTCCATCAGTCCCACCACCAGCTCCCAAAGGCTACTACCGACGTGG
GCACGGTCGTGGCTGTGGCTGCTGCCTCCTCAGCTTATTCGTCAAAGTAATCATATCCCT
TATTGTCATCCTCGGCGTAGCCGCTCTCATCTTCTGGCTCATCGTCCGACCTCGTGCCAT
CAAGTTTCACGTGACCGATGCGTCCCTTACCCGCTTTGACCACACTTCCCCGGACAACAT
TTTAAGGTATAACCTAGCCCTCACTGTTCCTGTCCGTAACCCAAACAAGAGGATCGGACT
CTACTACGATAGGATCGAAGCTCATGCCTACTACGAGGGAAAGCGGTTTAGTACCATCAC
GTTAACTCCTTTCTATCAAGGACACAAAAACACAACCGTTCTCACACCAACGTTCCAAGG
CCAAAAGAAAAACATATGGCTTCAAAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGA
CAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAA
ATCTTTATTTCGACGTGTCTACATT

Last Updated on 23.10.2014 13:25