SimpleSearch - Line and FST details


Line specific information

 
Line ID 246F07
Vector Used pAC161
Line Availability only available from NASC (N423587)
Segregation Analysis 50:26:23
Confirmed for Hit At2g35980
Parent of DUPLO pair none
Parent of pair(s) 3402, 7134

Gene hit At2g35980

 
Sequence (A. th genome BLAST matches underlined)
>54-K014441-022-246-F07-8409
CTGATCCATGTAGATTTCCCCGACATGAAGCACTTTATCGAAGGAATATAGTTCTGACTT
GTGGACTTGACGCGAACGCGCGGAACAGCGCGTATGGGATCTCTGTCGCTACATGAGTAG
AAAGGAGTTAACGTGATGGTACTAAACCGCTTTCCCTCGTAGTAGGCATGAGCTTCGATC
CTATCGTAGTAGAGTCCGATCCTCTTGTTTGGGTTACGGACAGGAACAGTGAGGGCTATG
GGATCCTCCCTTAAGTGAG
GenBank Accession AL940330 [GenBank]
Graphic View Graphic view of gene At2g35980
Predicted Position of Insertion Chr2:15111091 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) F11F19
Hit Gene Code At2g35980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940330 [GenBank]


Last Updated on 31.08.2016 09:40