Sequences from confirmation amplicon


Confirmation sequences for line 251C03 and hit At3g46840 are shown.
Line ID 251C03
Locus At3g46840 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:17252107
Primers used for PCR CR06 - 8474, show primer details
   
Sequence Name 36-K017190-022-251-C03C-CR06
GenBank Accession LN502031 [GenBank]
Sequencing primer gene specific primer, CR06: 5'-ACTACTTGAAGCTGATTTCCCGTA-3'
Sequence (A. th genome BLAST matches underlined)
>36-K017190-022-251-C03C-CR06
GGTACTTCTTTCCGTTAAGATCGAACGAATTTACCGATCTTCCCTGTTTAGCAACAAGCA
GTAATGTTAAAAGAGGACAAGATATGTATGATAATATGTTGTCGTAAGAGAGGAACAAAG
ATTTGTCCCTTGGTACTTTACCACAACTGTCTTGCCGTTTCCGAGAACAACTTTAGTGAC
AAACGCACGGTTAGTATTACTAGCAGCAACAGTGAACATCCACGGCGCAATACTCGCGAC
CGTGCTAGGTTCTGGACCACTGTTTCCTGCGGAATTCACTATGAGGATTCCCTTGGCCAT
GGCATGGAAAGCCCCGATCGCGATAGGGTCCTCCTCAAAAGGCGAACTATTATCACCACC
AATGGATATGGTAATGATGTCCACCTTATCCGCTATGGCATCATCAAATGCCGCTAGAAT
TCCGTCAGTTGTGCACCCATCGACGCCAGGGTCACATACTTTATAAACCGCTATTCTTGC
AGCTGGAACGCCACCTCTTGCGGTTCCATTGCCGAGGCCGTAAAAGCTCACTCAGCCGTG
GATGCTGTGTCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGG
ATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTT
TCAATT
   
Sequence Name 40-K017190-022-251-C03C-8409
GenBank Accession LN503540 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K017190-022-251-C03C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGACACAGCATCC
ACGGCTGAGTGAGCTTTTACGGCCTCGGCAATGGAACCGCAAGAGGTGGCGTTCCAGCTG
CAAGAATAGCGGTTTATAAAGTATGTGACCCTGGCGTCGATGGGTGCACAACTGACGGAA
TTCTAGCGGCATTTGATGATGCCATAGCGGATAAGGTGGACATCATTACCATATCCATTG
GTGGTGATAATAGTTCGCCTTTTGAGGAGGACCCTATCGCGATCGGGGCTTTCCATGCCA
TGGCCAAGGGAATCCTCATAGTGAATTCCGCAGGAAACAGTGGTCCAGAACCTAGCACGG
TCGCGAGTATTGCGCCGTGGATGTTCACTGTTGCTGCTAGTAATACTAACCGTGCGTTTG
TCACTAAAGTTGTTCTCGGAAACGGCAAGACAGTTGTGGTAAAGTACCAAGGGACAAATC
TTTGTTCCTCTCTTACGACAACATATTATCATACATATCTTGTCCTCTTTTAACATTACT
GCTTGTTGCTAAACAGGGAAGATCGGTAAATTCGTTCGATCTTAACGGAAAGAAGTACCC
TCTAGTATACGGGAAATCA

Last Updated on 07.07.2016 14:16