SimpleSearch - Line and FST details


Line specific information

 
Line ID 251C03
Vector Used pAC161
Line Availability only available from NASC (N424027)
Segregation Analysis 100:51:42
Confirmed for Hit At3g46840
Parent of DUPLO pair none
Parent of pair(s) 84670, 84677, 84686, 84687, 84688, 84689, 84690, 84691, 84693, 84694, 84695

Gene hit At3g46840

 
Sequence (A. th genome BLAST matches underlined)
>19-K014555-022-251-C03-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCTCTGGACA
CAGCATCCACGGCTGAGTGAGCTTTTACGGCCTCGGCAATGGAACCGCAAGAGGTGGCGT
TCCAGCTGCAAGAATAGCGGTTTATAAAGTATGTGACCCTGGCGTCGATGGGTGCACAAC
TGACGGAATTCTATCGGAATTTGATGATGCCATAGCGGATAAGGTGGACATCATTACCAT
ATCCATTGGTGGTGATAATAGTTCGCCTTTTGAGGAGGACCCTATCGCGATCGGGGCTTT
CCATGCCATGGCCAAGGGAATCCTCATAGTGAATTCCGCAGGAAACAGTGGTCCAGAACC
TATGGGATCCTCC
GenBank Accession BX649800 [GenBank]
Graphic View Graphic view of gene At3g46840
Predicted Position of Insertion Chr3:17252089 - go to primer design
BLAST e Value 1e-155
Hit Clone Code (BAC ID) T6H20
Hit Gene Code At3g46840 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Subtilase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23