Sequences from confirmation amplicon


Confirmation sequences for line 253F07 and hit At4g25950 are shown.
Line ID 253F07
Locus At4g25950 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:13173888
Primers used for PCR MD06 - 8474, show primer details
   
Sequence Name 53-K023834-022-253-F07C-8409
GenBank Accession LN508021 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K023834-022-253-F07C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCAAGGATATTGTCAAGATGC
TCATCAAGTATGTCACCACTACTGCAGCATGATTCTCACTACACCGCCCCCATCGTATCT
TATTCTCCTGATAATAAAACTGTTATGATTCTTCAGCTCTAGTTTTTTGGTCCGCGATTT
CTAATAGAGCCAAATACATAGTCCATTGGTAGAGAAACTCATAAATATATGGAAACTAAA
ACAAACATTAGATGAAAGTATCATTGTAAAAAAAAGAGGAGGGGATCGAAAACGAAACTA
AGTACACAAGTGATGAATTTTAAACATAAGTACAAAAGAGAACATGCATGCATGATAAAT
GCAATGTTTGGTAAATTTGTATCATATTCGTACTCTTGAGCAT
   
Sequence Name 57-K023834-022-253-F07C-MD06
GenBank Accession LN509291 [GenBank]
Sequencing primer gene specific primer, MD06: 5'-GTCCACATAATGCTCAAGAGTACG-3'
Sequence (A. th genome BLAST matches underlined)
>57-K023834-022-253-F07C-MD06
ATATGATACAAATTTACCAAACATTGCATTTATCATGCATGCATGTTCTCTTTTGTACTT
ATGTTTAAAATTCATCACTTGTGTACTTAGTTTCGTTTTCGATCCCCTCCTCTTTTTTTT
ACAATGATACTTTCATCTAATGTTTGTTTTAGTTTCCATATATTTATGAGTTTCTCTACC
AATGGACTATGTATTTGGCTCTATTAGAAATCGCGGACCAAAAAACTAGAGCTGAAGAAT
CATAACAGTTTTATTATCAGGAGAATAAGATACGATGGGGGCGGTGTAGTGAGAATCATG
CTGCAGTAGTGGTGACATACTTGATGAGCATCTTGACAATATCCTTGGATATATTCAATT
GTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATAT
GGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAG
CGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTA
TAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACA
TTC
Primers used for PCR MD07 - 8474, show primer details
   
Sequence Name 01-K023835-022-253-F07C-8409
GenBank Accession LN486410 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K023835-022-253-F07C-8409
TAGATTTCCCGGACATGAAGCCATTTAAGGTTCGTAATCCTGACATCTGTCTCATCATCT
AAACGTTTTGCATCTGCTTCTTGATCCGTCTGAAACAAAAGGTAAAGAATATGAGTACAA
ATCAAGATATCTCACTAGCCGGTTTTGTTTCGGTGTTGCTTACCCCAGAAACTTGAGTTT
GATACTCTTCTTCTAATCGGGATCTGTATTCTTCCATCTCCTTCTCAGCCTCATCTTTCG
CTTGCTTCATTCTTGCTAGTTTTGCTGATCATCGATCCGTCCATACAAAAAGAAAAGAAA
AGCGCTGAAAAGGATTCAAAACCAAAATCTTACTATTAGAGCCAACAAGCCATAAAGGAG
AAAGAGACTATACCGGTCCTCGCAGCTGAAACAATCCGTCCGGCTTCTTGTTCAGCAGTT
AAAAGCATCTGAATCCCACCTTGGCCTCTTAAAGAATCCATGGCTTATGTTCTCTTCAAA
GACAATGAAAAGTTGTGTTTATTCTTCTGCAAATTTTGGTGCCAGAAGTGGAATTTGTAA
ATATAAGCCTATTTGGTTATGGTTTGGATTAGACGGAGAGTGTTTTTCTCCTTGGTTCAT
GGAGTTAGTTTTTGACTCATTATTTCTTTCTTCAAATTTAGATGCTTTTAAAAAGACAAT
GTGCGATCTCCGGGTGAGTGTGGAAGGAAAAAATAAAATATATCTCAAACATACTATTTA
TA
   
Sequence Name 05-K023835-022-253-F07C-MD07
GenBank Accession LN488182 [GenBank]
Sequencing primer gene specific primer, MD07: 5'-TTGTAATCGGTTGGGATTTTCTAT-3'
Sequence (A. th genome BLAST matches underlined)
>05-K023835-022-253-F07C-MD07
TGTTTGAGATATATTTTATTTTTTCCTTCCACACTCACCCGGAGATCGCACATTGTCTTT
TTAAAAGCATCTAAATTTGAAGAAAGAAATAATGAGTCAAAAACTAACTCCATGAACCAA
GGAGAAAAACACTCTCCGTCTAATCCAAACCATAACCAAATAGGCTTATATTTACAAATT
CCACTTCTGGCACCAAAATTTGCAGAAGAATAAACACAACTTTTCATTGTCTTTGAAGAG
AACATAAGCCATGGATTCTTTAAGAGGCCAAGGTGGGATTCAGATGCTTTTAACTGCTGA
ACAAGAAGCCGGACGGATTGTTTCAGCTGCGAGGACCGGTATAGTCTCTTTCTCCTTTAT
GGCTTGTTGGCTCTAATAGTAAGATTTTGGTTTTGAATCCTTTTCAGCGCTTTTCTTTTC
TTTTTGTATGGACGGATCGATGATCAGCAAAACTAGCAAGAATGAAGCAAGCGAAAGATG
AGGCTGAGAAGGAGATGGAAGAATACAGATCCCGATTAGAAGAAGAGTATCAAACTCAAG
TTTCTGGGGTAAGCAACACCGAAACAAAACCGGCTAGTGAGATATCTTGATTTGTACTCA
TATTCTTTACCTTTTGTTTCAGACGGATCAAGAAGCAGATGCAAAACGTTTAGATGATGA
GACAGATGTCAGGATTACGAACCTTAAATGGCTTCATGTCCGG

Last Updated on 07.07.2016 14:16