SimpleSearch - Line and FST details


Line specific information

 
Line ID 253F07
Vector Used pAC161
Line Availability only available from NASC (N424259)
Segregation Analysis 50:47:34
Confirmed for Hit At4g25950
Parent of DUPLO pair none
Parent of pair(s) 10794, 73952

Gene hit At4g25950

 
Sequence (A. th genome BLAST matches underlined)
>54-K014574-022-253-F07-8409
CTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAGTTGAATATATCTCGACGTA
TATTGTCATGATGTCTCACTCTAGTATGTTCACCACTACTGTCCCCATGATTCTCACTAG
CACCGACCCCATCGTCTCTTATTCTCCTGATACTAACACTGTTATGATTCTTCAGCGCTA
TGGGATCCTCCCTTTAGTGAGACTCTTCTTCTAATCGGGATCTGTATTCTTCCATCTCCT
TCTCAGCCTCATCTTTCGCTTGCTTCATTCTTGCTATGGGATCCTCCCTTAAGTGAG
GenBank Accession AL940967 [GenBank]
Graphic View Graphic view of gene At4g25950
Predicted Position of Insertion Chr4:13173904 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) F14M19
Hit Gene Code At4g25950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation vacuolar ATP synthase G3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940967 [GenBank]


Last Updated on 31.08.2016 09:40