Sequences from confirmation amplicon


Confirmation sequences for line 253H07 and hit At3g59480 are shown.
Line ID 253H07
Locus At3g59480 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:21983960
Primers used for PCR NK01 - 8474, show primer details
   
Sequence Name 29-K102590-0022-253-H07C-8409
GenBank Accession LN499235 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K102590-0022-253-H07C-8409
GAGCCATTTACATTAGAGTGCCACAGAGACAAAGCAGTCTCATCATCAACCTTATCAGAT
CCAGTCAAGAACATAAGCTCTTCATCGCTGACTTTGATCACTTCAGCTTTGTCCCAGATG
CTAAGAATCTGCTTCTGAGCCTCCTCCTTCGAGGGCCACAAAGGAAGCCTCAAGTTCGGA
TCATATGAAAGCAACGCACCAGCTTCCTTAGCCACCTCCATGGCTTTCAAGTGAGCAGAT
CGACATGGCTCAACGATCAAGCTTATGGATCCGTAGTGGAACACCTTAGCCTGTGTAAAA
CAAAAACAAAACAGAGCACTCATTAACCTAACTTGACATCTACGTTACGTATACCAACAA
CCGTTACGTTAATGATGTAGCACCGTTCGCTAATTAAGGTGGAGAC
   
Sequence Name 29-K102591-0022-253-H07C-NK01
GenBank Accession LN499236 [GenBank]
Sequencing primer gene specific primer, NK01: 5'-TGTCTCACATTTAATTAGCGAACG-3'
Sequence (A. th genome BLAST matches underlined)
>29-K102591-0022-253-H07C-NK01
CGTAGATGTCAGTTAGGTTAATGAGTGCTCTGTCTTGTTTTTGTTTTACACAGGCTAAGG
TGTTCCACTACGGATCCATAAGCTTGATCGTTGAGCCATGTCGATCTGCTCACTTGAAAG
CCATGGAGGTGGCTAAGGAAGCTGGTGCGTTGCTTTCATATGATCCGAACTTGAGGCTTC
CTTTGTGGCCCTCGAAGGAGGAGGCTCAGAAGCAGATTCTTAGCATCTGGGACAAAGCTG
AAGTGATCAAAGTCAGCGATGAAGAGCTTATGTTCTTGACTGGATCTGATAAGGTTGATG
ATGAGACTGCTTTGTCTCTGTGGCACTCTAATTGTAAATGGCTTCATGTCCGGGAAATCT
ACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAAT
TTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTT
GATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTC
TAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAA

Last Updated on 23.10.2014 13:25