SimpleSearch - Line and FST details


Line specific information

 
Line ID 253H07
Vector Used pAC161
Line Availability only available from NASC (N424283)
Segregation Analysis 50:42:37
Confirmed for Hit At3g59480
Parent of DUPLO pair none
Parent of pair(s) 1416, 3809, 8313, 48638, 87450, 87451

Gene hit At3g59480

 
Sequence (A. th genome BLAST matches underlined)
>56-K014578-022-253-H07-8409
TTGATCCATGTACGATTTCCCGGACATGAANGCCTTTACAATTAGAGTGCCACAGAGACA
AAGCTGTCTCATCATCAACCTTATCAGATCCAGTCAAGAACATAAGCTCTTCATCGCTGA
CTTTGATCACTTCAGCTTTGTCCCAGATGCTAAGAATCTGCTTCTGAGCCTCCTCCTTCG
AGGGCCACAAAGGAAGCCTCAAGTTCGGATCATATGAAAGCAACGCACCAGCTTCCTTAG
CCACCTCCATGGCTTTCAAGTGAGCAGATCGACATGGCTCAACGATCAAGCTTATGGATC
CGTAGTGGAACACCTTAACCTGTGTAAAACAAAAACAAAACAGAGCACTCATTAACCTAA
CTTGACATCTACGTTACGTATACCAACACCCGTTACGTTAATGATGTACCACCGCTCGCT
AATTAAATGTGAGACACGGACCCAAAAAAGAATTTGCCTACGTGTCATATATTAATTAAA
AATAAAAATAACGTACAGATCTGATGACATCAAGATTGAGCTCGTTCGGACGGAGGAGCT
TATCGGCCCTAGGG
GenBank Accession AL940996 [GenBank]
Graphic View Graphic view of gene At3g59480
Predicted Position of Insertion Chr3:21983960 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F25L23
Hit Gene Code At3g59480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation pfkB-like carbohydrate kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940995 [GenBank]


Last Updated on 31.08.2016 09:40