Sequences from confirmation amplicon


Confirmation sequences for line 257E09 and hit At4g24450 are shown.
Line ID 257E09
Locus At4g24450 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:12638748
Primers used for PCR BM14 - 8474, show primer details
   
Sequence Name 37-K021737-022-257-E09C-8409
GenBank Accession LN502459 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K021737-022-257-E09C-8409
TGAGCCATTTACAATCGGACATGGCCCCATAGTATCAGAGCCTCGTTTCAGAAGTGATTC
TAAAGAAGGACTCATCCGTGACCTTACAATGTACTTGAAAACATTAAAGGTATACCACTT
GCAGCCTAGTTTCGTTTCCTGATCCATTGAAGAATTCTTAGGAGCAAACTGTAATGGTTA
GTTAGCTTAGTAATGATGAGAATATTTATACCTCTGGCCTCTATTAGATAATAATTGCTT
TGCAATTTCGACCTACATTACAGAACAATATTTTGCTCCATTTTCTACTTTCAGTATCTT
GAATTTCTAAACAAACTGTTTGTACCTGCCTCTGTAGGCAGTTCATTCAGGTGCAGACCT
TGAGTCTGCTATTGATACGTTCCTTTC
   
Sequence Name 38-K021737-022-257-E09C-BM14
GenBank Accession LN502837 [GenBank]
Sequencing primer gene specific primer, BM14: 5'-TTACCTTAGATGGAGAAAGGAACG-3'
Sequence (A. th genome BLAST matches underlined)
>38-K021737-022-257-E09C-BM14
ATGACTGCCTACGAGGCAGGTACAAACAGTTTGTTTAGAAATTCAAGATACTGAAAGTAG
AAAATGGAGCAAAATATTGTTCTGTAATGTAGGTCGAAATTGCAAAGCAATTATTATCTA
ATAGAGGCCAGAGGTATAAATATTCTCATCATTACTAAGCTAACTAACCATTACAGTTTG
CTCCTAAGAATTCTTCAATGGATCAGGAAACGAAACTAGGCTGCAAGTGGTATACCTTTA
ATGTTTTCAAGTACATTGTAAGGTCACGGATGAGTCCTTCTTTAGAATCACTTCTGAAAC
GAGGCTCTGATACTATGGGGCCATGTCCGATTGTAAATGGCTTCATGTCCGGGAAATCTA
CATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATT
TTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTG
ATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCT
AATTCGGAAATCTTTATTTCGACGTGTCTACAT
Primers used for PCR BM13 - 8474, show primer details
   
Sequence Name 73-K021739-022-257-E09C-8409
GenBank Accession LN512812 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>73-K021739-022-257-E09C-8409
CTTGGTATGTTTTCTTTTTCTTTTTCTTTTGTGAGACCATTGGTCTGTCGTGTTTGCCAG
TATGCATCGATCCTGAAGTCAGATCTCACCTAGTTCAAGAGAGCCTATGGCAGAAGAAAT
AAACTCATCAGATATTTACAACAGGAAACTAAACTTCTGAACTAGCTAGTTAGCTGCTTT
TTAAGAAGTAGCGAGTTTTAGAATGGAGTTTCAACTTTATCTGAGATGTTATTCTTCCTC
TTATTTACCAATCACTAAATGTGAGTATCTTACTTCAAATGGAAGCATCTTTACCTCACA
AATTATCACATCATCTGCGCTACTGTTGTTGTGCAACTTTTGGTGCCACTCTTCCATCAT
GCCGGATTTGCAGTGGTTATTTCTCTAACAAAAGATAATAAAGACAAGAAAATGTTAAAA
CAAAAAAGAAAGAAAGTACAAAGACAAACTACTCTAACAAGACAAGGAAAAGTTTTAGTT
GCAGAGATTTTGAACTATATACCTGAATAACAAGGATTTCGTCACGGATTCTCTGCCCAA
CATCACCTTGACCTCCACGACCCACAAGTGCCATAGTTAGTCTCACAATTTCTCTCTTAT
TTGGTTGCNTGCAAAT
   
Sequence Name 74-K021739-022-257-E09C-BM13
GenBank Accession LN512984 [GenBank]
Sequencing primer gene specific primer, BM13: 5'-TATTTGCAGCAACCAAATAAGAGA-3'
Sequence (A. th genome BLAST matches underlined)
>74-K021739-022-257-E09C-BM13
CTTGTGGGTCGTGGAGGTCAGGTGATGTTGGGCAGAGAATCCGTGACGACATCCTTGTTA
TTCAGGTATATAGTTCAAAATCTCTGCAACTAAAACTTTTCCTTGTCTTGTTAGAGTAGT
TTGTCTTTGTACTTTCTTTCTTTTTTGTTTTAACATTTTCTTGTCTTTATTATCTTTTGT
TAGAGAAATAACCACTGCAAATCCGGCATGATGGAAGAGTGGCACCAAAAGTTGCACAAC
AACAGTAGCGCAGATGATGTGATAATTTGTGAGGTAAAGATGCTTCCATTTGAAGTAAGA
TACTCACATTTAGTGATTGGTAAATAAGAGGAAGAATAACATCTCAGATAAAGTTGAAAC
TCCATTCTAAAACTCGCTACTTCTTAAAAAGCAGCTAACTAGCTAGTTCAGAAGTTTAGT
TTCCTGTTGTAAATATCTGATGAGTTTATTTCTTCTGCCATAGGCTCTCTTGAACTATGT
GAGATCTGACTTCAGGATCGATGCATACTGGCAAACACTACAGACCAATGGTCTCACAAA
AGAAAAAGAAAAAGAAAACATTACCAAGTATAAAATGAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTA
CGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTA
TTTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16