SimpleSearch - Line and FST details


Line specific information

 
Line ID 257E09
Vector Used pAC161
Line Availability only available from NASC (N424633)
Segregation Analysis 100:37:33
Confirmed for Hit At4g24450
Parent of DUPLO pair 113
Parent of pair(s) none

Gene hit At4g24450

 
Sequence (A. th genome BLAST matches underlined)
>69-K014921-022-257-E09-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGGCATTGACAATCGGACATGGCCCCATAGT
ATAAGAGCCTCGTTTCAGAAGTGATTCTAAAGAAGGACTCATCCGTGACCTTACAATGTA
CTTGAAAACATTAAAGGTATACCACTTGCAGCCTATGGGATCCTCCTATGAGTGAGCTAA
ACTTCTGAACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL941427 [GenBank]
Graphic View Graphic view of gene At4g24450
Predicted Position of Insertion Chr4:12638767 - go to primer design
BLAST e Value 4e-50
Hit Clone Code (BAC ID) T22A6
Hit Gene Code At4g24450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phosphoglucan, water dikinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL941427 [GenBank]


Last Updated on 31.08.2016 09:40