Sequences from confirmation amplicon


Confirmation sequences for line 259F07 and hit At1g01390 are shown.
Line ID 259F07
Locus At1g01390 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:149109
Primers used for PCR MZ24 - 8474, show primer details
   
Sequence Name 05-K024137-022-259-F07C-MZ24
GenBank Accession LN488184 [GenBank]
Sequencing primer gene specific primer, MZ24: 5'-TTTATCAACGAAGAAAAGTCTCCC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K024137-022-259-F07C-MZ24
GGCGGTTCTCGTCGTCGATATGTTTGGTGCGGATGCGTTCGACGTGGCCGTTGACTTCCA
CGTGTCACCATACATTTTCTATGCATCCAATGCAAACGTCTTGTCGTTTTTTCTTCACTT
GCCGAAACTAGACAAAACGGTGTCGTGTGAGTTTAGGTACTTAACCGAACCGCTTAAGAT
TCCCGGCTGTGTCCCGATAACCGGTAAGGACTTTCTTGATACGGTTCAAGACCGAAACGA
CGACGCATACAAATTGCTTCTCCATAACACCAAGAGGTACAAAGAAGCTAAAGGGATTCT
AGTGAATTCCTTCGTTGATTTTTTTCAACATGGCTTCATGTCCGGGAAATCTACATGGAT
CAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTC
AATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAAC
GACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGG
AAATCTTTATTTCGACGTGTCTACATTC
   
Sequence Name 06-K024137-022-259-F07C-8409
GenBank Accession LN488633 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>06-K024137-022-259-F07C-8409
GATCCATGTAGATTTCCCGGACATGAAGCCATGTTGAAAAAAATCAACGAAGGAATTCAC
TAGAATCCCTTTAGCTTCTTTGTACCTCTTGGTGTTATGGAGAAGCAATTTGTATGCGTC
GTCGTTTCGGTCTTGAACCGTATCAAGAAAGTCCTTACCGGTTATCGGGACACAGCCGGG
AATCTTAAGCGGTTCGGTTAAGTACCTAAACTCACACGACACCGTTTTGTCTAGTTTCGG
CAAGTGAAGAAAAAACGACAAGACGTTTGCATTGGATGCATAGAAAATGTATGGTGACAC
GTGGAAGTCAACGGCCACGTCGAACGCATCCGCACCAAACATATCGACGACGAGAACCGC
CGGGAGACTTTTCTTCTTTGATAAAACAAGTGAAGAAAAAACGACAAGACGTTTGCATTG
GATGCATAGAAAATGTATGGTGACACGTGGAAGTCAACGGCCACGTCGAACGCATCCGCA
CCAAACATATCGACGACGAGAACCGCCGGGAGACTTTTCTTCTTTGATAA
Primers used for PCR MZ23 - 8474, show primer details
   
Sequence Name 15-K024137-022-259-F07C-MZ23
GenBank Accession LN492793 [GenBank]
Sequencing primer gene specific primer, MZ23: 5'-CACCCAAGACTCTAACAACTCCTT-3'
Sequence (A. th genome BLAST matches underlined)
>15-K024137-022-259-F07C-MZ23
AACTCCTTCACTTTATTTCCTATGGCTTTTCCCTCTTCACCTTCCATCAGTGCCTTCACC
ACTCTCACCACTTCTTCCCTCCGTACAATCCCATCTTCACCCGCATGGATTCTTAGAGCC
GCTCCAACATCCTCCACGAGTAGCAATGTATTCATCTTTTGCTCCGCGAATAAAGGCCAC
GCTATGAGTGGTACACCGTTTACAATGCTTTCTAAGGTCGAATTCCATCCACAGTGTGTT
AAAAACCCGCATGTGGATGGATGAGCCAGGATTTGAACCTGTGGAGCCCATGATGGAACC
ACCAAACCTTTCTCTTTGGTTCGGTCTAAGAACCCAATTGGTAAAAACGAAAAGGGGTCT
GTCTCGCTGTGTGGATTGAAATACGACGAACTAACTATCTCGCTTGGACTTCGTATGACC
CAAATAAACCGTTTTCCGCTCTCCGCAAGACCAATAGCAAGCTCATTAAACTGCTCACAT
GTAAGTGTTCCGCCGCTTCCAAATGATATGTATAGAACCGAGCCGAATGGTTGGTTGTCT
AGCCAACTTAAACATCCGAACTTGTCTTCCAAGTTAACATTAGATGAACTTGTGTTAACC
AGCGGCCCAATCGGGTATACCGTTGGTTTATCAGGATATATTCAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
   
Sequence Name 16-K024137-022-259-F07C-ORIL
GenBank Accession LN493262 [GenBank]
Sequencing primer gene specific primer, ORIL: unknown
Sequence (A. th genome BLAST matches underlined)
>16-K024137-022-259-F07C-ORIL
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATAAACCAACGG
TATACCCGATTGGGCCGCTGGTTAACACAAGTTCATCTAATGTTAACTTGGAAGACAAGT
TCGGATGTTTAAGTTGGCTAGACAACCAACCATTCGGCTCGGTTCTATACATATCATTTG
GAAGCGGCGGAACACTTACATGTGAGCAGTTTAATGAGCTTGCTATTGGTCTTGCGGAGA
GCGGAAAACGGTTTATTTGGGTCATACGAAGTCCAAGCGAGATAGTTAGTTCGTCGTATT
TCAATCCACACAGCGAGACAGACCCCTTTTCGTTTTTACCAATTGGGTTCTTAGACCGAA
CCAAAGAGAAAGGTTTGGTGGTTCCATCATGGGCTCCACAGGTTCAAATCCTGGCTCATC
CATCCACATGCGGGTTTTTAACACACTGTGGATGGAATTCGACCTTAGAAAGCATTGTAA
ACGGTGTACCACTCATAGCGTGGCCTTTATTCGCGGAGCAAAAGATGAATACATTGCTAC
TCGTGGAGGATGTTGGAGCGGCTCTAAGAATCCATGCGGGTGAAGATGGGATTGTACGGA
GGGAAGAAGTGGTGAGAGTGGTGAAGGCACTGATGGAAGGTGAAGAGGGAAAAGCCATAG
GAAATAAAGTGAAGGAGTTGAAAGAAGGAGTT

Last Updated on 23.10.2014 13:25