SimpleSearch - Line and FST details


Line specific information

 
Line ID 259F07
Vector Used pAC161
Line Availability only available from NASC (N424835)
Segregation Analysis 50:49:40
Confirmed for Hit At1g01390
Parent of DUPLO pair none
Parent of pair(s) 69089, 97381

Gene hit At1g01390

 
Sequence (A. th genome BLAST matches underlined)
>54-K014916-022-259-F07-8409
CTGATCCATGGTAGATTTCCCGGGACATGAAGCCTGTTGAATAGAATAACGAAGGAATTC
ACTAGAATCCCTTTAGCTTCTTTGTACCTCTTGGTGCTATGGGATCCTCCTATAAGTGAG
ACANGTTCGGATGTTTAAGTTGGCTAGACAACCAACCATTCGGCTCGGTTCTATACATAT
CATTTGGAAGCGGCGGAACACTTACATGTGAGCAGTTTAATGAGCTTGCTATGGGATCCT
CCCTTNAGTGAG
GenBank Accession AL941648 [GenBank]
Graphic View Graphic view of gene At1g01390
Predicted Position of Insertion Chr1:149063 - go to primer design
BLAST e Value 5e-56
Hit Clone Code (BAC ID) F6F3
Hit Gene Code At1g01390 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23