Sequences from confirmation amplicon


Confirmation sequences for line 260F08 and hit At5g35410 are shown.
Line ID 260F08
Locus At5g35410 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:13636868
Primers used for PCR JK10 - 8474, show primer details
   
Sequence Name 29-K020436-022-260-F08C-8409
GenBank Accession LN499100 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K020436-022-260-F08C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTCTTCAAAAACTTGT
ACTTCAATTGTTAAACTAAAACCTCAGTATCTGTCTTAGCTAAAGTTACTTTTACTTGTT
TTTCATTAAGTTGACCTGTCAATTGCACTTGTTCACAGGGCAGTTATGTAGCGGAGAATG
TAGAGAGAAATGATGAAGGGCCCCTGATGATGAATGCCTTTGAGATGATTACCTTATCAC
AAGGCTTAAATTTATCTGCACTATTTGACAGGCGACAGGTAGTACCTGATTTTCTATTAC
TGGTCATAGAGATCTCCATTTCGAATAAAAGAATGTC
   
Sequence Name 30-K020436-022-260-F08C-JK10
GenBank Accession LN499538 [GenBank]
Sequencing primer gene specific primer, JK10: 5'-ACCGACATTCTTTTATTCGAAATG-3'
Sequence (A. th genome BLAST matches underlined)
>30-K020436-022-260-F08C-JK10
ATCTCTATGACCAGTAATAGAAAATCAGGTACTACCTGTCGCCTGTCAAATAGTGCAGAT
AAATTTAAGCCTTGTGATAAGGTAATCATCTCAAAGGCATTCATCATCAGGGGCCCTTCA
TCATTTCTCTCTACATTCTCCGCTACATAACTGCCCTGTGAACAAGTGCAATTGACAGGT
CAACTTAATGAAAAACAAGTAAAAGTAACTTTAGCTAAGACAGATACTGAGGTTTTAGTT
TAACAATTGAAGTACAAGTTTTTGAAGACAGGATATATTCAATTGTAAATGGCTTCATGT
CCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAG
TAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGA
AAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAA
ACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16